Browse
Submit Data
Databases
API
Help

Dataset Information

10 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

DNA Uptake by Type IV Filaments.

ABSTRACT: Bacterial uptake of DNA through type IV filaments is an essential component of natural competence in numerous gram-positive and gram-negative species. Recent advances in the field have broadened our understanding of the structures used to take up extracellular DNA. Here, we review seminal experiments in the literature describing DNA binding by type IV pili, competence pili and the flp pili of Micrococcus luteus; collectively referred to here as type IV filaments. We compare the current state of the field on mechanisms of DNA uptake for these three appendage systems and describe the current mechanistic understanding of both DNA-binding and DNA-uptake by these versatile molecular machines.

SUBMITTER: Piepenbrink KH

PROVIDER: S-EPMC6370729 | biostudies-literature | 2019

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

DNA Uptake by Type IV Filaments.

Piepenbrink Kurt H KH

Frontiers in molecular biosciences 20190205

Bacterial uptake of DNA through type IV filaments is an essential component of natural competence in numerous gram-positive and gram-negative species. Recent advances in the field have broadened our understanding of the structures used to take up extracellular DNA. Here, we review seminal experiments in the literature describing DNA binding by type IV pili, competence pili and the flp pili of <i>Micrococcus luteus</i>; collectively referred to here as type IV filaments. We compare the current st ...[more]

PMID: 30805346

Similar Datasets

Retraction of DNA-bound type IV competence pili initiates DNA uptake during natural transformation in Vibrio cholerae.

Project description:Natural transformation is a broadly conserved mechanism of horizontal gene transfer in bacterial species that can shape evolution and foster the spread of antibiotic resistance determinants, promote antigenic variation and lead to the acquisition of novel virulence factors. Surface appendages called competence pili promote DNA uptake during the first step of natural transformation 1 ; however, their mechanism of action has remained unclear owing to an absence of methods to visualize these structures in live cells. Here, using the model naturally transformable species Vibrio cholerae and a pilus-labelling method, we define the mechanism for type IV competence pilus-mediated DNA uptake during natural transformation. First, we show that type IV competence pili bind to extracellular double-stranded DNA via their tip and demonstrate that this binding is critical for DNA uptake. Next, we show that type IV competence pili are dynamic structures and that pilus retraction brings tip-bound DNA to the cell surface. Finally, we show that pilus retraction is spatiotemporally coupled to DNA internalization and that sterically obstructing pilus retraction prevents DNA uptake. Together, these results indicate that type IV competence pili directly bind to DNA via their tip and mediate DNA internalization through retraction during this conserved mechanism of horizontal gene transfer.

| S-EPMC6582970 | biostudies-literature

Diversification of the type IV filament superfamily into machines for adhesion, protein secretion, DNA uptake, and motility.

Project description:Processes of molecular innovation require tinkering and shifting in the function of existing genes. How this occurs in terms of molecular evolution at long evolutionary scales remains poorly understood. Here, we analyse the natural history of a vast group of membrane-associated molecular systems in Bacteria and Archaea-the type IV filament (TFF) superfamily-that diversified in systems involved in flagellar or twitching motility, adhesion, protein secretion, and DNA uptake. The phylogeny of the thousands of detected systems suggests they may have been present in the last universal common ancestor. From there, two lineages-a bacterial and an archaeal-diversified by multiple gene duplications, gene fissions and deletions, and accretion of novel components. Surprisingly, we find that the 'tight adherence' (Tad) systems originated from the interkingdom transfer from Archaea to Bacteria of a system resembling the 'EppA-dependent' (Epd) pilus and were associated with the acquisition of a secretin. The phylogeny and content of ancestral systems suggest that initial bacterial pili were engaged in cell motility and/or DNA uptake. In contrast, specialised protein secretion systems arose several times independently and much later in natural history. The functional diversification of the TFF superfamily was accompanied by genetic rearrangements with implications for genetic regulation and horizontal gene transfer: systems encoded in fewer loci were more frequently exchanged between taxa. This may have contributed to their rapid evolution and spread across Bacteria and Archaea. Hence, the evolutionary history of the superfamily reveals an impressive catalogue of molecular evolution mechanisms that resulted in remarkable functional innovation and specialisation from a relatively small set of components.

| S-EPMC6668835 | biostudies-literature

Specific DNA recognition mediated by a type IV pilin.

Project description:Natural transformation is a dominant force in bacterial evolution by promoting horizontal gene transfer. This process may have devastating consequences, such as the spread of antibiotic resistance or the emergence of highly virulent clones. However, uptake and recombination of foreign DNA are most often deleterious to competent species. Therefore, model naturally transformable gram-negative bacteria, including the human pathogen Neisseria meningitidis, have evolved means to preferentially take up homotypic DNA containing short and genus-specific sequence motifs. Despite decades of intense investigations, the DNA uptake sequence receptor in Neisseria species has remained elusive. We show here, using a multidisciplinary approach combining biochemistry, molecular genetics, and structural biology, that meningococcal type IV pili bind DNA through the minor pilin ComP via an electropositive stripe that is predicted to be exposed on the filaments surface and that ComP displays an exquisite binding preference for DNA uptake sequence. Our findings illuminate the earliest step in natural transformation, reveal an unconventional mechanism for DNA binding, and suggest that selective DNA uptake is more widespread than previously thought.

| S-EPMC3581936 | biostudies-literature

Transient Silencing of a Type IV P-Type ATPase, Atp10c, Results in Decreased Glucose Uptake in C2C12 Myotubes.

Project description:Atp10c is a strong candidate gene for diet-induced obesity and type 2 diabetes. To identify molecular and cellular targets of ATP10C, Atp10c expression was altered in vitro in C2C12 skeletal muscle myotubes by transient transfection with an Atp10c-specific siRNA. Glucose uptake assays revealed that insulin stimulation caused a significant 2.54-fold decrease in 2-deoxyglucose uptake in transfected cells coupled with a significant upregulation of native mitogen-activated protein kinases (MAPKs), p38, and p44/42. Additionally, glucose transporter-1 (GLUT1) was significantly upregulated; no changes in glucose transporter-4 (GLUT4) expression were observed. The involvement of MAPKs was confirmed using the specific inhibitor SB203580, which downregulated the expression of native and phosphorylated MAPK proteins in transfected cells without any changes in insulin-stimulated glucose uptake. Results indicate that Atp10c regulates glucose metabolism, at least in part via the MAPK pathway, and, thus, plays a significant role in the development of insulin resistance and type 2 diabetes.

| S-EPMC3317196 | biostudies-literature

Uptake of glucose-conjugated MGMT inhibitors in cancer cells: role of flippases and type IV P-type ATPases.

Project description:The DNA repair protein O 6-methylguanine-DNA-methyltransferase (MGMT) is a key determinant of cancer resistance. The MGMT inhibitors O 6-benzylguanine (O6BG) and O 6-(4-bromothenyl)guanine (O6BTG) failed to enhance the therapeutic response due to toxic side effects when applied in combination with alkylating chemotherapeutics, indicating a need of inhibitor targeting. We assessed MGMT targeting that relies on conjugating the inhibitors O6BG and O6BTG to ß-D-glucose, resulting in O6BG-Glu and O6BTG-Glu, respectively. This targeting strategy was selected by taking advantage of high demand of glucose in cancers. Contrary to our expectation, the uptake of O6BG-Glu and O6BTG-Glu was not dependent on glucose transporters. Instead, it seems that after membrane binding the conjugates are taken up via flippases, which normally transport phospholipids. This membrane binding is the consequence of the amphiphilic character of the conjugates, which at higher concentrations lead to the formation of micelle-like particles in aqueous solution. The unusual uptake mechanism of the conjugates highlights the importance of proper linker selection for a successful ligand-based drug delivery strategy. We also demonstrate that proteins of the P4-Type ATPase family are involved in the transport of the glucose conjugates. The findings are not only important for MGMT inhibitor targeting, but also for other amphiphilic drugs.

| S-EPMC5655675 | biostudies-literature

Cleavage of phosphorothioated DNA and methylated DNA by the type IV restriction endonuclease ScoMcrA.

Project description:Many taxonomically diverse prokaryotes enzymatically modify their DNA by replacing a non-bridging oxygen with a sulfur atom at specific sequences. The biological implications of this DNA S-modification (phosphorothioation) were unknown. We observed that simultaneous expression of the dndA-E gene cluster from Streptomyces lividans 66, which is responsible for the DNA S-modification, and the putative Streptomyces coelicolor A(3)2 Type IV methyl-dependent restriction endonuclease ScoA3McrA (Sco4631) leads to cell death in the same host. A His-tagged derivative of ScoA3McrA cleaved S-modified DNA and also Dcm-methylated DNA in vitro near the respective modification sites. Double-strand cleavage occurred 16-28 nucleotides away from the phosphorothioate links. DNase I footprinting demonstrated binding of ScoA3McrA to the Dcm methylation site, but no clear binding could be detected at the S-modified site under cleavage conditions. This is the first report of in vitro endonuclease activity of a McrA homologue and also the first demonstration of an enzyme that specifically cleaves S-modified DNA.

| S-EPMC3009677 | biostudies-literature

Definition of a bacterial type IV secretion pathway for a DNA substrate.

Project description:Bacteria use conjugation systems, a subfamily of the type IV secretion systems, to transfer DNA to recipient cells. Despite 50 years of research, the architecture and mechanism of action of the channel mediating DNA transfer across the bacterial cell envelope remains obscure. By use of a sensitive, quantifiable assay termed transfer DNA immunoprecipitation (TrIP), we identify contacts between a DNA substrate (T-DNA) and 6 of 12 components of the VirB/D4 conjugation system of the phytopathogen Agrobacterium tumefaciens. Our results define the translocation pathway for a DNA substrate through a bacterial conjugation machine, specifying the contributions of each subunit of the secretory apparatus to substrate passage.

| S-EPMC3882297 | biostudies-literature

Secretion of Chromosomal DNA by the Neisseria gonorrhoeae Type IV Secretion System.

Project description:Approximately 80% of Neisseria gonorrhoeae and 17.5% of Neisseria meningitidis clinical isolates carry a ~59 kb genomic island known as the gonococcal genetic island (GGI). About half of the GGI consists of genes encoding a type IV secretion system (T4SS), and most of these genes are clustered in a ~28 kb region at one end of the GGI. Two additional genes (parA and parB) are found at the other end of the island. The remainder of the GGI consists mostly of hypothetical proteins, with several being identified as DNA-binding or DNA-processing proteins. The T4SS genes show similarity to those of the F-plasmid family of conjugation systems, with similarity in gene order and a low but significant level of sequence identity for the encoded proteins. However, several GGI-encoded proteins are unique from the F-plasmid system, such as AtlA, Yag, and TraA. Interestingly, the gonococcal T4SS does not act as a conjugation system. Instead, this T4SS secretes ssDNA into the extracellular milieu, where it can serve to transform highly competent Neisseria species, thereby increasing the transfer of genetic information. Although many of the T4SS proteins are expressed at low levels, this system has been implicated in several cellular processes. The secreted ssDNA is involved in the initial stages of biofilm formation, and the presence of the T4SS enables TonB-independent intracellular survival of N. gonorrhoeae strains during infection of cervical cells. Other GGI-like T4SSs have been identified in several other ?-, ?-, and ?-proteobacteria, but the function of these GGI-like T4SSs is unknown. Remarkably, the presence of the GGI is related to resistance to several antibiotics. Here, we describe our current knowledge about the GGI and its unique ssDNA-secreting T4SS.

| S-EPMC5935271 | biostudies-literature

Recruitment of conjugative DNA transfer substrate to Agrobacterium type IV secretion apparatus.

Project description:Bacterial type IV secretion system (T4SS) belongs to a growing class of evolutionarily conserved transporters that translocate DNA and proteins into a wide variety of organisms including bacterial and eukaryotic cells. Archetypal is the Agrobacterium tumefaciens VirB/D4 T4SS that transfers oncogenic T-DNA to various eukaryotic cells, which is transferred as a nucleoprotein T-complex with VirD2 as the pilot protein. As a derivative of plasmid conjugation systems, the VirB/D4 T4SS can also transfer certain mobilizable plasmids and bacterial proteins like VirE2 and VirF, although it is unknown how the membrane-bound T4SS recruits different transfer substrates. Here, we show that a cytoplasmic VirD2-binding protein (VBP) is involved in the recruitment of the T-complex to the energizing components of the T4SS, including VirD4, VirB4, and VirB11. VBP is also important for the recruitment of a conjugative plasmid to a different transfer system independent of VirB/D4. These data indicate that VBP functions as a previously unrecognized recruiting protein that helps couple nucleoprotein substrates to the appropriate transport sites for conjugative DNA transfers. VBP has three functionally redundant homologs, and similar homologs can be found in different bacterial genomes, suggesting a previously uncharacterized class of proteins involved in conjugative DNA transfers.

| S-EPMC2148415 | biostudies-literature

Viral detection using DNA functionalized gold filaments.

Project description:Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.

| S-EPMC2867084 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data