Dataset Information

Cryptococcal meningitis is a cause for cross-reactivity in cerebrospinal fluid assays for anti-Histoplasma, anti-Coccidioides and anti-Blastomyces antibodies.

ABSTRACT: BACKGROUND/OBJECTIVES:Antibody detection is commonly used for diagnosis of histoplasmosis, and cross-reactions have been recognised due to endemic mycoses but not cryptococcosis. We observed cross-reactions in an anti-Histoplasma antibody enzyme immunoassay (EIA) in the cerebrospinal fluid (CSF) from a patient with cryptococcal meningitis and sought to assess the risk of cross-reactive anti-Histoplasma antibodies in persons with cryptococcal meningitis. METHODS:An anti-cryptococcal antibody EIA was developed to measure CSF antibody response in HIV-infected subjects from Kampala, Uganda and previously healthy, HIV-negative subjects at the National Institutes of Health (NIH) with cryptococcal meningitis. Specimens were tested for cross-reactivity in assays for IgG anti-Histoplasma, anti-Blastomyces and anti-Coccidioides antibodies. RESULTS:Among 61 subjects with cryptococcal meningitis (44 Kampala cohort, 17 NIH cohort), elevated CSF anti-cryptococcal antibody levels existed in 38% (23/61). Of the 23 CSF specimens containing elevated anti-cryptococcal antibodies, falsely positive results were detected in antibody EIAs for histoplasmosis (8/23, 35%), coccidioidomycosis (6/23, 26%) and blastomycosis (1/23, 4%). Overall, 2% (2/81) of control CSF specimens had elevated anti-cryptococcal antibody detected, both from Indiana. CONCLUSIONS:Cryptococcal meningitis may cause false-positive results in the CSF for antibodies against Histoplasma, Blastomyces and Coccidioides. Fungal antigen testing should be performed to aid in differentiating true- and false-positive antibody results in the CSF.

SUBMITTER: Bahr NC

PROVIDER: S-EPMC6380936 | biostudies-literature | 2019 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Cryptococcal meningitis is a cause for cross-reactivity in cerebrospinal fluid assays for anti-Histoplasma, anti-Coccidioides and anti-Blastomyces antibodies.

Bahr Nathan C NC Panackal Anil A AA Durkin Michelle M MM Smedema Melinda L ML Keown Wesley W Davis Thomas E TE Raymond-Guillen Luke L Park Yoon-Dong YD Marr Kieren A KA Fries Bettina C BC Williamson Peter R PR Boulware David R DR Wheat L Joseph LJ

Mycoses 20190101 3

<h4>Background/objectives</h4>Antibody detection is commonly used for diagnosis of histoplasmosis, and cross-reactions have been recognised due to endemic mycoses but not cryptococcosis. We observed cross-reactions in an anti-Histoplasma antibody enzyme immunoassay (EIA) in the cerebrospinal fluid (CSF) from a patient with cryptococcal meningitis and sought to assess the risk of cross-reactive anti-Histoplasma antibodies in persons with cryptococcal meningitis.<h4>Methods</h4>An anti-cryptococca ...[more]

PMID: 30565753

Similar Datasets

Project description:Background(1→3)-β-d-Glucan (BDG) is a helpful diagnostic marker for many invasive fungal infections. However, BDG is not thought to be useful in diagnosing cryptococcosis. We evaluated the utility of BDG as an adjunct diagnostic tool for patients infected with human immunodeficiency virus (HIV) and presenting with suspected cryptococcal meningitis.MethodsThe Fungitell assay was used to measure BDG concentrations in cerebrospinal fluid (CSF) (n = 177) and serum (n = 109) of HIV-infected Ugandans and South Africans with suspected meningitis. Correlations between BDG concentrations and quantitative CSF cryptococcal cultures, CSF cryptococcal antigen (CRAG) titers, and 18 different CSF cytokine concentrations were assessed using non-parametric tests. Mixed models evaluated longitudinal changes in CSF BDG concentrations. Survival analyses were used to evaluate BDG's relationship with mortality.ResultsThe Fungitell BDG assay provided 89% sensitivity and 85% specificity in CSF for cryptococcal meningitis. Serum sensitivity was suboptimal (79%). Cerebrospinal fluid BDG concentrations at diagnosis were median (interquartile range) 343 (200-597) pg/mL in cryptococcal patients and 37 (23-46) pg/mL in patients without cryptococcosis. Sensitivity in CSF improved to 98% (53 of 54) when initial fungal burdens were ≥10 000 colony-forming units/mL. (1→3)-β-d-Glucan normalized rapidly after initiating antifungal therapy. Baseline BDG concentrations correlated with CSF fungal burden (rho = 0.820; P < .001), CSF CRAG lateral flow assay titers (rho = 0.780, P < .001), and monocyte chemotactic protein-1 levels in CSF (P = .047). In patients with cryptococcal meningitis, BDG ≥500 pg/mL at diagnosis was associated with increased 10-week mortality.Conclusions(1→3)-β-d-Glucan is detectable in the CSF of HIV-infected patients with Cryptococcus, and it may provide useful prognostic information. Sensitivity is less than CRAG; however, BDG normalizes rapidly, unlike CRAG, making BDG potentially useful in diagnosing recurrent episodes.

Project description:BackgroundCryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.MethodsThe CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.ResultsThe 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.ConclusionsThe metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Dataset Information

Cryptococcal meningitis is a cause for cross-reactivity in cerebrospinal fluid assays for anti-Histoplasma, anti-Coccidioides and anti-Blastomyces antibodies.

Publications

Cryptococcal meningitis is a cause for cross-reactivity in cerebrospinal fluid assays for anti-Histoplasma, anti-Coccidioides and anti-Blastomyces antibodies.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets