Dataset Information

Molecular characterization of haemagglutinin-neuraminidase gene among virulent Newcastle disease viruses isolated in Iran.

ABSTRACT:

Background

Virulent Newcastle disease virus (vNDV) causes great economic losses to the poultry industry throughout the world. Despite the endemicity of Newcastle disease (ND) and occurrence of recurrent outbreaks, the nature and genetic features of circulating NDV strains in Iran are largely unknown. Aims: This study was conducted to characterize 13 NDV isolates obtained from different outbreaks in various regions of Iran during 1999-2000 by sequencing and phylogenetic analysis of complete coding sequences of haemagglutinin-neuraminidase (HN) gene.

Methods

All isolates were analyzed based on the previously determined in vivo pathogenicity indices and amino acid (aa) sequences of fusion (F) protein cleavage site (FPCS).

Results

Phylogenetic analysis based on the HN gene coding region revealed a very close relationship of these viruses with the recently defined genotype XIII, and more specifically, subgenotype XIIIa viruses. Analysis of HN gene nucleotide (nt) sequences revealed that all studied isolates encode for a protein length of 571 aa and there is no C-terminal extension on HN aa sequences. Sequence analysis revealed multiple aa residue substitutions at antigenic sites or neutralizing epitopes on the HN glycoprotein of studied viruses compared with commonly used vaccinal strains.

Conclusion

In this study, molecular characterization of vNDV isolates, obtained from commercial poultry farms in Iran, were conducted through complete sequencing and analysis of HN gene. Isolation and molecular characterization of further NDV isolates from other parts of Iran and from neighboring countries in the region will be helpful to identify the nature and origin of indigenous viruses.

SUBMITTER: Soltani M

PROVIDER: S-EPMC6509910 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Project description:IntroductionNewcastle disease virus (NDV) cultures held in the isolate collections in Ethiopia between 1976 and 2008 were not characterized using biological and molecular techniques. The already characterized NDV isolates belonged to genotype VI but the genetic nature of previously collected isolates, which could shade light on the history of introduction into the country and their evolutionary relationships, were not established.MethodsA total of 14 NDVs (11 obtained from outbreak cases in chickens and three commercial vaccinal strains used in the country) were inoculated into specific pathogen free (SPF) embryonated chicken eggs (ECE). Allantoic fluids harvested from grown SPF ECE were tested by heamagglutination (HA) and heamagglutination inhibition (HI) tests. Partial F gene sequences were generated for all samples and molecular evolutionary relationships were reconstructed together with reference sequences freely available online. The pathogenicities of the isolates were assessed in vivo by determining their intracerebral pathogenicity index (ICPI) in day-old chicks and molecularly by determination of F gene cleavage sites.ResultsOf these, 12 viruses (two vaccines and 10 outbreaks) were successfully propagated as evidenced by a positive heamagglutination (HA) test. These 12 propagated viruses were further characterized by heamagglutination inhibition (HI) test, of which only three viruses reacted with monoclonal antibody (MAb 617/616) specific for pigeon paramyxovirus-1. In addition, all 14 viruses were characterized by partial fusion (F) gene sequencing and phylogenetic tree reconstruction. The Ethiopian NDV isolates clustered with genotype VI viruses, forming two clades (groups 1 and 2) that have ancestral relationships with Egypt-1990 and Sudan-1975 like viruses.DiscussionThe characterized genotype VI NDVs were genetically similar to currently circulating NDVs in Ethiopia. The isolates had cleavage sites consistent with mesogenic/velogenic NDV with a mean ICPI value of 1.76, indicating that the isolates were velogenic. Two and four highly virulent viruses were thermostable at 56°C for 2 hours and 1 hour, respectively. To reduce chicken mortality and production losses, proper control of the disease should be instituted using high quality and protective vaccines together with strong biosecurity measures.