Dataset Information

Hemagglutinin-neuraminidase Sequence and Phylogenetic Analysis of Two Newcastle Disease Virus Isolated from Chickens in Iran.

ABSTRACT: Newcastle disease is a highly contagious viral infection affecting many species of birds that can spread fast between poultry houses and cause a heavy economic burden on the poultry industry all around the world. Fusion and hemagglutinin-neuraminidase (HN) protein are important in the pathogenesis of the Newcastle disease virus (NDV). The HN protein is a critical viral protein with multiple functions and plays a key role in the formation of the virulence of NDV. Head of HN protein is responsible for receptor binding, neuraminidase activity. This study aimed to investigate the sequence homology of hemagglutinin-neuraminidase of two NDV isolates sampled from infected farms in Iran. The samples were collected from flocks that had been vaccinated by both types of live and killed vaccines for NDV. After isolation of NDV, the viruses were subjected to the polymerase chain reaction (PCR) amplification using two pairs of specific primers designed for the HN gene to amplify the complete HN gene (1730bp). Afterward, the PCR products were sequenced and analyzed by phylogenetic tree construction software. Based on the analysis, substantial sequence homology among Iranian isolates is within the range of 97.1-100%. Moreover, the sequence homology searching revealed a level of similarity between HN sequences of Iranian isolates and the HN sequences from other countries, particularly Asian ones. For instance, a high homology ratio (95.34%) was found between Iranian isolates and the sequences registered on online molecular databases from China. Based on phylogenetic analysis, the NDV isolates belong to the VIId genotype. Finally, it can be concluded that monitoring the circulation of NDVs among poultry and other birds can help to obtain an insight into the evolution of NDVs and control of panzootic viruses in the future.

SUBMITTER: Kiani MH

PROVIDER: S-EPMC8410199 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Hemagglutinin-neuraminidase Sequence and Phylogenetic Analysis of Two Newcastle Disease Virus Isolated from Chickens in Iran.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets