Browse
Submit Data
Databases
API
Help

Dataset Information

9 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A neurotoxin that specifically targets Anopheles mosquitoes.

ABSTRACT: Clostridial neurotoxins, including tetanus and botulinum neurotoxins, generally target vertebrates. We show here that this family of toxins has a much broader host spectrum, by identifying PMP1, a clostridial-like neurotoxin that selectively targets anopheline mosquitoes. Isolation of PMP1 from Paraclostridium bifermentans strains collected in anopheline endemic areas on two continents indicates it is widely distributed. The toxin likely evolved from an ancestral form that targets the nervous system of similar organisms, using a common mechanism that disrupts SNARE-mediated exocytosis. It cleaves the mosquito syntaxin and employs a unique receptor recognition strategy. Our research has an important impact on the study of the evolution of clostridial neurotoxins and provides the basis for the use of P. bifermentans strains and PMP1 as innovative, environmentally friendly approaches to reduce malaria through anopheline control.

SUBMITTER: Contreras E

PROVIDER: S-EPMC6599013 | biostudies-literature | 2019 Jun

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

A neurotoxin that specifically targets Anopheles mosquitoes.

Contreras Estefania E Masuyer Geoffrey G Qureshi Nadia N Chawla Swati S Dhillon Harpal S HS Lee Han Lim HL Chen Jianwu J Stenmark Pål P Gill Sarjeet S SS

Nature communications 20190628 1

Clostridial neurotoxins, including tetanus and botulinum neurotoxins, generally target vertebrates. We show here that this family of toxins has a much broader host spectrum, by identifying PMP1, a clostridial-like neurotoxin that selectively targets anopheline mosquitoes. Isolation of PMP1 from Paraclostridium bifermentans strains collected in anopheline endemic areas on two continents indicates it is widely distributed. The toxin likely evolved from an ancestral form that targets the nervous sy ...[more]

PMID: 31253776

Similar Datasets

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

Rickettsia species in African Anopheles mosquitoes.

Project description:BackgroundThere is higher rate of R. felis infection among febrile patients than in healthy people in Sub-Saharan Africa, predominantly in the rainy season. Mosquitoes possess a high vectorial capacity and, because of their abundance and aggressiveness, likely play a role in rickettsial epidemiology.Methodology/principal findingsQuantitative and traditional PCR assays specific for Rickettsia genes detected rickettsial DNA in 13 of 848 (1.5%) Anopheles mosquitoes collected from Côte d'Ivoire, Gabon, and Senegal. R. felis was detected in one An. gambiae molecular form S mosquito collected from Kahin, Côte d'Ivoire (1/77, 1.3%). Additionally, a new Rickettsia genotype was detected in five An. gambiae molecular form S mosquitoes collected from Côte d'Ivoire (5/77, 6.5%) and one mosquito from Libreville, Gabon (1/88, 1.1%), as well as six An. melas (6/67, 9%) mosquitoes collected from Port Gentil, Gabon. A sequence analysis of the gltA, ompB, ompA and sca4 genes indicated that this new Rickettsia sp. is closely related to R. felis. No rickettsial DNA was detected from An. funestus, An. arabiensis, or An. gambiae molecular form M mosquitoes. Additionally, a BLAST analysis of the gltA sequence from the new Rickettsia sp. resulted in a 99.71% sequence similarity to a species (JQ674485) previously detected in a blood sample of a Senegalese patient with a fever from the Bandafassi village, Kedougou region.ConclusionR. felis was detected for the first time in An. gambiae molecular form S, which represents the major African malaria vector. The discovery of R. felis, as well as a new Rickettsia species, in mosquitoes raises new issues with respect to African rickettsial epidemiology that need to be investigated, such as bacterial isolation, the degree of the vectorial capacity of mosquitoes, the animal reservoirs, and human pathogenicity.

| S-EPMC3484133 | biostudies-literature

Laser induced mortality of Anopheles stephensi mosquitoes.

Project description:Small, flying insects continue to pose great risks to both human health and agricultural production throughout the world, so there remains a compelling need to develop new vector and pest control approaches. Here, we examined the use of short (<25 ms) laser pulses to kill or disable anesthetized female Anopheles stephensi mosquitoes, which were chosen as a representative species. The mortality of mosquitoes exposed to laser pulses of various wavelength, power, pulse duration, and spot size combinations was assessed 24 hours after exposure. For otherwise comparable conditions, green and far-infrared wavelengths were found to be more effective than near- and mid-infrared wavelengths. Pulses with larger laser spot sizes required lower lethal energy densities, or fluence, but more pulse energy than for smaller spot sizes with greater fluence. Pulse duration had to be reduced by several orders of magnitude to significantly lower the lethal pulse energy or fluence required. These results identified the most promising candidates for the lethal laser component in a system being designed to identify, track, and shoot down flying insects in the wild.

| S-EPMC4758184 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

SOA confers X chromosome dosage compensation in Anopheles gambiae mosquitoes

Project description:This SuperSeries is composed of the SubSeries listed below.

2023-07-25 | GSE210630 | GEO

Transmission potential of Rickettsia felis infection by Anopheles gambiae mosquitoes.

Project description:A growing number of recent reports have implicated Rickettsia felis as a human pathogen, paralleling the increasing detection of R. felis in arthropod hosts across the globe, primarily in fleas. Here Anopheles gambiae mosquitoes, the primary malarial vectors in sub-Saharan Africa, were fed with either blood meal infected with R. felis or infected cellular media administered in membrane feeding systems. In addition, a group of mosquitoes was fed on R. felis-infected BALB/c mice. The acquisition and persistence of R. felis in mosquitoes was demonstrated by quantitative PCR detection of the bacteria up to day 15 postinfection. R. felis was detected in mosquito feces up to day 14. Furthermore, R. felis was visualized by immunofluorescence in salivary glands, in and around the gut, and in the ovaries, although no vertical transmission was observed. R. felis was also found in the cotton used for sucrose feeding after the mosquitoes were fed infected blood. Natural bites from R. felis-infected An. gambiae were able to cause transient rickettsemias in mice, indicating that this mosquito species has the potential to be a vector of R. felis infection. This is particularly important given the recent report of high prevalence of R. felis infection in patients with "fever of unknown origin" in malaria-endemic areas.

| S-EPMC4491796 | biostudies-other

Increased Threat of Urban Malaria from Anopheles stephensi Mosquitoes, Africa.

Project description:Malaria continues to be a major health threat in Africa, mainly in rural areas. Recently, the urban malaria vector Anopheles stephensi invaded Djibouti and Ethiopia, potentially spreading to other areas of Africa. Urgent action is needed to prevent urban malaria epidemics from emerging and causing a public health disaster.

| S-EPMC6590739 | biostudies-other

Kinetics of Plasmodium midgut invasion in Anopheles mosquitoes.

Project description:Malaria-causing Plasmodium parasites traverse the mosquito midgut cells to establish infection at the basal side of the midgut. This dynamic process is a determinant of mosquito vector competence, yet the kinetics of the parasite migration is not well understood. Here we used transgenic mosquitoes of two Anopheles species and a Plasmodium berghei fluorescence reporter line to track parasite passage through the mosquito tissues at high spatial resolution. We provide new quantitative insight into malaria parasite invasion in African and Indian Anopheles species and propose that the mosquito complement-like system contributes to the species-specific dynamics of Plasmodium invasion.

| S-EPMC7526910 | biostudies-literature

Rice volatiles lure gravid malaria mosquitoes, Anopheles arabiensis.

Project description:Mosquito oviposition site selection is essential for vector population dynamics and malaria epidemiology. Irrigated rice cultivations provide ideal larval habitats for malaria mosquitoes, which has resulted in increased prevalence of the malaria vector, Anopheles arabiensis, in sub-Saharan Africa. The nature and origin of the cues regulating this behaviour are only now being elucidated. We show that gravid Anopheles arabiensis are attracted and oviposit in response to the odour present in the air surrounding rice. Furthermore, we identify a synthetic rice odour blend, using electrophysiological and chemical analyses, which elicits attraction and oviposition in laboratory assays, as well as attraction of free-flying gravid mosquitoes under semi-field conditions. This research highlights the intimate link between malaria vectors and agriculture. The identified volatile cues provide important substrates for the development of novel and cost-effective control measures that target female malaria mosquitoes, irrespective of indoor or outdoor feeding and resting patterns.

| S-EPMC5128813 | biostudies-literature

Comparative transcriptome analyses of deltmethrin resistant and suscpetible Anopheles gambiae mosquitoes

Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test

2012-10-01 | GSE39269 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data