Comparative transcriptome analyses of deltmethrin resistant and suscpetible Anopheles gambiae mosquitoes
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles gambiae
PROVIDER: GSE39269 | GEO | 2012/10/01
SECONDARY ACCESSION(S): PRJNA170440
REPOSITORIES: GEO
Similar Datasets
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin
2012-10-01 | E-GEOD-39269 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Changes in gene expression in whole Anopheles gambiae female bodies between virgin mosquitoes and females samples at 2h, 6h, and 24h after mating.
2009-01-01 | E-MEXP-1868 | biostudies-arrayexpress
Project description:Anopheles gambiae mosquitoes play an important role in malaria transmission. In sub-Saharan Africa, the dry season can last several months. The mechanisms for mosquito population to survive through the dry season are poorly understood. One possible mechanism is that adults increase their desiccation tolerance over the dry season. Genetic analyses have shown that inversions 2La, 2Rb, 2Rc, 2Rd and 2Ru are associated with aridity resistance, however little is known about the transcriptional response of genes in response to desiccation. The results of the present study demonstrate that desiccation affects expression of genes associated with several mosquito physiological mechanisms, including those that protect against water loss, but all structural related genes decreased their expression. The identified differentially expressed genes in response to desiccation stress can lay a foundation for better understanding of molecular mechanisms underling dry-season survival of An. gambiae mosquitoes, so it may provide a different option for malaria vector control. Transcriptional profiles of Anopheles gambiae female mosquitoes were exposed to 70% (standard) or 30% (desiccated) RH without any access to sugar and water at 0hr, 18hr or 36hr.
2011-12-31 | E-GEOD-25433 | biostudies-arrayexpress
Project description:Anopheline mosquitoes frequently take multiple blood meals in a single gonotrophic cycle. In this study we determined patterns of gene expression in Anopheles gambiae females blood fed twice within the first gonotrophic cycle.
2010-07-08 | GSE22806 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Anopheles gambiae mosquitoes play an important role in malaria transmission. In sub-Saharan Africa, the dry season can last several months. The mechanisms for mosquito population to survive through the dry season are poorly understood. One possible mechanism is that adults increase their desiccation tolerance over the dry season. Genetic analyses have shown that inversions 2La, 2Rb, 2Rc, 2Rd and 2Ru are associated with aridity resistance, however little is known about the transcriptional response of genes in response to desiccation. The results of the present study demonstrate that desiccation affects expression of genes associated with several mosquito physiological mechanisms, including those that protect against water loss, but all structural related genes decreased their expression. The identified differentially expressed genes in response to desiccation stress can lay a foundation for better understanding of molecular mechanisms underling dry-season survival of An. gambiae mosquitoes, so it may provide a different option for malaria vector control.
2011-12-31 | GSE25433 | GEO
Project description:We aimed at identifying the genes regulated by wounding in Anopheles gambiae. Gene expression was compared between wounded and non-wounded mosquitoes, 3h after wounding. Wounding was induced by the injection of dsLacZ using a thin glass needle.
2013-06-05 | E-MEXP-3677 | biostudies-arrayexpress
Project description:Transcriptome profiling of three DDT resistant strains of Anopheles gambiae in Cameroon (Gare, Messa and Nkolondom- 2 M forms and one S form) compared to the susceptible strain Ngousso (M form) and Kisumu (S form). S-form is distributed across sub-Saharan Africa and breeds mostly in association with rain-dependent pools and temporary puddles. M-form distribution overlaps with that of S-form in West and Central Africa, but the former form is apparently absent east of the Great Rift Valley; it is able to exploit relatively more permanent breeding sites, often closely associated with human activities, such those created by irrigation, rice cultivation and urbanization (Santolamazza et al., 2011).
2013-10-24 | E-MTAB-1382 | biostudies-arrayexpress
Project description:With their genome sequenced, Anopheles gambiae mosquitoes now serve as a powerful tool for basic research in comparative, evolutionary and developmental biology. The knowledge generated by these studies is expected to reveal molecular targets for novel vector control and pathogen transmission blocking strategies. Comparisons of gene-expression profiles between adult male and nonblood-fed female Anopheles gambiae mosquitoes revealed that roughly 22% of the genes showed sex-dependent regulation. Blood-fed females switch the majority of their metabolism to blood digestion and egg formation within 3 h after the meal is ingested, in detriment to other activities such as flight and response to environment stimuli. Changes in gene expression are most evident during the first, second and third days after a blood meal, when as many as 50% of all genes showed significant variation in transcript accumulation. After laying the first cluster of eggs (between 72 and 96 h after the blood meal), mosquitoes return to a nongonotrophic stage, similar but not identical to that of 3-dayold nonblood-fed females. Ageing and/or the nutritional state of mosquitoes at 15 days after a blood meal is reflected by the down-regulation of 5% of all genes. A full description of the large number of genes regulated at each analysed time point and each biochemical pathway or biological processes in which they are involved is not possible within the scope of this contribution. Therefore, we present descriptions of groups of genes displaying major differences in transcript accumulation during the adult mosquito life. However, a publicly available searchable database (Anopheles gambiae Gene Expression Database at UC Irvine) has been made available so that detailed analyses of specific groups of genes based on their descriptions, functions or levels of gene expression variation can be performed by interested investigators according to their needs. Keywords: response to bloodmeal
2007-08-20 | GSE8822 | GEO