Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Comparative transcriptome analyses of deltmethrin resistant and suscpetible Anopheles gambiae mosquitoes

ABSTRACT: we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test

ORGANISM(S): Anopheles gambiae

PROVIDER: GSE39269 | GEO | 2012/10/01

SECONDARY ACCESSION(S): PRJNA170440

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Comparative transcriptome analyses of deltmethrin resistant and suscpetible Anopheles gambiae mosquitoes

Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin

2012-10-01 | E-GEOD-39269 | biostudies-arrayexpress

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

Transcription profiling of Anopheles gambiae female bodies from virgin mosquitoes and 2, 6 and 24 hours after mating

Project description:Changes in gene expression in whole Anopheles gambiae female bodies between virgin mosquitoes and females samples at 2h, 6h, and 24h after mating.

2009-01-01 | E-MEXP-1868 | biostudies-arrayexpress

Genome-wide Transcriptional Analysis of Genes Associated with Desiccation Stress in Anopheles gambiae

Project description:Anopheles gambiae mosquitoes play an important role in malaria transmission. In sub-Saharan Africa, the dry season can last several months. The mechanisms for mosquito population to survive through the dry season are poorly understood. One possible mechanism is that adults increase their desiccation tolerance over the dry season. Genetic analyses have shown that inversions 2La, 2Rb, 2Rc, 2Rd and 2Ru are associated with aridity resistance, however little is known about the transcriptional response of genes in response to desiccation. The results of the present study demonstrate that desiccation affects expression of genes associated with several mosquito physiological mechanisms, including those that protect against water loss, but all structural related genes decreased their expression. The identified differentially expressed genes in response to desiccation stress can lay a foundation for better understanding of molecular mechanisms underling dry-season survival of An. gambiae mosquitoes, so it may provide a different option for malaria vector control. Transcriptional profiles of Anopheles gambiae female mosquitoes were exposed to 70% (standard) or 30% (desiccated) RH without any access to sugar and water at 0hr, 18hr or 36hr.

2011-12-31 | E-GEOD-25433 | biostudies-arrayexpress

Expression data from Anopheles gambiae females blood fed twice within a gonotrophic cycle

Project description:Anopheline mosquitoes frequently take multiple blood meals in a single gonotrophic cycle. In this study we determined patterns of gene expression in Anopheles gambiae females blood fed twice within the first gonotrophic cycle.

2010-07-08 | GSE22806 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Genome-wide Transcriptional Analysis of Genes Associated with Desiccation Stress in Anopheles gambiae

2011-12-31 | GSE25433 | GEO

Transcription profiling by array of wounded and non-wounded Anopheles gambiae mosquitoes to investigate genes regulated by wounding

Project description:We aimed at identifying the genes regulated by wounding in Anopheles gambiae. Gene expression was compared between wounded and non-wounded mosquitoes, 3h after wounding. Wounding was induced by the injection of dsLacZ using a thin glass needle.

2013-06-05 | E-MEXP-3677 | biostudies-arrayexpress

Transcriptome profiling of three DDT resistant strains of Anopheles gambiae in Cameroon

Project description:Transcriptome profiling of three DDT resistant strains of Anopheles gambiae in Cameroon (Gare, Messa and Nkolondom- 2 M forms and one S form) compared to the susceptible strain Ngousso (M form) and Kisumu (S form). S-form is distributed across sub-Saharan Africa and breeds mostly in association with rain-dependent pools and temporary puddles. M-form distribution overlaps with that of S-form in West and Central Africa, but the former form is apparently absent east of the Great Rift Valley; it is able to exploit relatively more permanent breeding sites, often closely associated with human activities, such those created by irrigation, rice cultivation and urbanization (Santolamazza et al., 2011).

2013-10-24 | E-MTAB-1382 | biostudies-arrayexpress

Anopheles gambiae brain proteomic analysis

Project description:Proteomic analysis of Anopheles gambiae brain tissue after in-gel trypsin digestion. To gain insights into neurobiology of the Anopheles gambiae mosquito, we carried out a proteomic analysis of its brain using a comprehensive proteomic approach.

2016-12-20 | PXD000630 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data