Dataset Information

Peer review of the pesticide risk assessment of the active substances Pepino Mosaic Virus,EU strain, mild isolate Abp1 and Pepino Mosaic Virus,CH2 strain, mild isolate Abp2.

ABSTRACT: The conclusions of the EFSA following the peer review of the initial risk assessments carried out by the competent authority of the rapporteur Member State, Spain, for the pesticide active substances Pepino Mosaic Virus, EU strain, mild isolate Abp1 and Pepino Mosaic Virus, CH2 strain, mild isolate Abp2 and the considerations as regards the inclusion of the substances in Annex IV of Regulation (EC) No 396/2005 are reported. The context of the peer review was that required by Regulation (EC) No 1107/2009 of the European Parliament and of the Council. The conclusions were reached on the basis of the evaluation of the representative use of Pepino Mosaic Virus, EU strain, mild isolate Abp1 and Pepino Mosaic Virus, CH2 strain, mild isolate Abp2 as an elicitor on tomato (permanent greenhouse production systems). The reliable endpoints, appropriate for use in regulatory risk assessment, are presented. Missing information identified as being required by the regulatory framework is listed.

SUBMITTER: European Food Safety Authority (EFSA)

PROVIDER: S-EPMC7801954 | biostudies-literature | 2021 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Peer review of the pesticide risk assessment of the active substances Pepino Mosaic Virus,EU strain, mild isolate Abp1 and Pepino Mosaic Virus,CH2 strain, mild isolate Abp2.

Anastassiadou Maria M Arena Maria M Auteri Domenica D Brancato Alba A Bura Laszlo L Carrasco Cabrera Luis L Chaideftou Eugenia E Chiusolo Arianna A Crivellente Federica F De Lentdecker Chloe C Egsmose Mark M Fait Gabriella G Greco Luna L Ippolito Alessio A Istace Frederique F Jarrah Samira S Kardassi Dimitra D Leuschner Renata R Lostia Alfonso A Lythgo Christopher C Magrans Oriol O Mangas Iris I Miron Ileana I Molnar Tunde T Padovani Laura L Parra Morte Juan Manuel JM Pedersen Ragnor R Reich Hermine H Santos Miguel M Sharp Rachel R Szentes Csaba C Terron Andrea A Tiramani Manuela M Vagenende Benedicte B Villamar-Bouza Laura L

EFSA journal. European Food Safety Authority 20210112 1

The conclusions of the EFSA following the peer review of the initial risk assessments carried out by the competent authority of the rapporteur Member State, Spain, for the pesticide active substances Pepino Mosaic Virus, EU strain, mild isolate Abp1 and Pepino Mosaic Virus, CH2 strain, mild isolate Abp2 and the considerations as regards the inclusion of the substances in Annex IV of Regulation (EC) No 396/2005 are reported. The context of the peer review was that required by ...[more]

PMID: 33473252

Similar Datasets

Project description:BackgroundPepino mosaic virus (PepMV) is an emerging plant pathogen that infects tomatoes worldwide. Understanding the factors that influence its evolutionary success is essential for developing new control strategies that may be more robust against the evolution of new viral strains. One of these evolutionary factors is the distribution of mutational fitness effect (DMFE), that is, the fraction of mutations that are lethal, deleterious, neutral, and beneficial on a given viral strain and host species. The goal of this study was to characterize the DMFE of introduced nonsynonymous mutations on a mild isolate of PepMV from the Chilean 2 strain (PepMV-P22). Additionally, we also explored whether the fitness effect of a given mutation depends on the gene where it appears or on epistatic interactions with the genetic background. To address this latter possibility, a subset of mutations were also introduced in a mild isolate of the European strain (PepMV-P11) and the fitness of the resulting clones measured.ResultsA collection of 25 PepMV clones each containing a single nucleotide nonsynonymous substitution was created by site-directed mutagenesis and the fitness of each mutant was determined. PepMV-P22 genome showed a high degree of robustness against point mutations, with 80% of mutations being either neutral or even beneficial and only 20% being deleterious or lethal. We found that the effect of mutations strongly depended on the gene in which they were introduced. Mutations with the largest average beneficial effects were those affecting the RdRp gene, in contrast to mutations affecting TGB1 and CP genes, for which the average effects were deleterious. Moreover, significant epistatic interactions were observed between nonsynonymous mutations and the genetic background, meaning that the effect of a given nucleotide substitution on a particular genomic context cannot be predicted by knowing its effect in a different one.ConclusionsOur results indicated that PepMV genome has a surprisingly high robustness against mutations. We also found that fitness consequences of a given mutation differ between the two strains analyzed. This discovery suggests that the strength of selection, and thus the rates of evolution, vary among PepMV strains.

Project description:Plant and virus materials, inoculation and symptom evaluation Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA). Microarray sample preparation and determination of viral titers Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

Project description:Virus emergence is a complex phenomenon, which generally involves spread to a new host from a wild host, followed by adaptation to the new host. Although viruses account for the largest fraction of emerging crop pathogens, knowledge about their emergence is incomplete. We address here the question of whether Pepino Mosaic Virus (PepMV) emergence as a major tomato pathogen worldwide could have involved spread from wild to cultivated plant species and host adaptation. For this, we surveyed natural populations of wild tomatoes in southern Peru for PepMV infection. PepMV incidence, genetic variation, population structure, and accumulation in various hosts were analyzed. PepMV incidence in wild tomatoes was high, and a strain not yet reported in domestic tomato was characterized. This strain had a wide host range within the Solanaceae, multiplying efficiently in most assayed Solanum species and being adapted to wild tomato hosts. Conversely, PepMV isolates from tomato crops showed evidence of adaptation to domestic tomato, possibly traded against adaptation to wild tomatoes. Phylogenetic reconstructions indicated that the most probable ancestral sequence came from a wild Solanum species. A high incidence of PepMV in wild tomato relatives would favor virus spread to crops and its efficient multiplication in different Solanum species, including tomato, allowing its establishment as an epidemic pathogen. Later, adaptation to tomato, traded off against adaptation to other Solanum species, would isolate tomato populations from those in other hosts.Virus emergence is a complex phenomenon involving multiple ecological and genetic factors and is considered to involve three phases: virus encounter with the new host, virus adaptation to the new host, and changes in the epidemiological dynamics. We analyze here if this was the case in the recent emergence of Pepino Mosaic Virus (PepMV) in tomato crops worldwide. We characterized a new strain of PepMV infecting wild tomato populations in Peru. Comparison of this strain with PepMV isolates from tomato crops, plus phylogenetic reconstructions, supports a scenario in which PepMV would have spread to crops from wild tomato relatives, followed by adaptation to the new host and eventually leading to population isolation. Our data, which derive from the analysis of field isolates rather than from experimental evolution approaches, significantly contribute to understanding of plant virus emergence, which is necessary for its anticipation and prevention.

Dataset Information

Peer review of the pesticide risk assessment of the active substances Pepino Mosaic Virus,EU strain, mild isolate Abp1 and Pepino Mosaic Virus,CH2 strain, mild isolate Abp2.

Publications

Peer review of the pesticide risk assessment of the active substances <i>Pepino Mosaic Virus</i>,EU strain, mild isolate Abp1 and <i>Pepino Mosaic Virus</i>,CH2 strain, mild isolate Abp2.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure