Browse
Submit Data
Databases
API
Help

Dataset Information

19 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Adaptive introgression of the beta-globin cluster in two Andean waterfowl.

ABSTRACT: Introgression of beneficial alleles has emerged as an important avenue for genetic adaptation in both plant and animal populations. In vertebrates, adaptation to hypoxic high-altitude environments involves the coordination of multiple molecular and cellular mechanisms, including selection on the hypoxia-inducible factor (HIF) pathway and the blood-O₂ transport protein hemoglobin (Hb). In two Andean duck species, a striking DNA sequence similarity reflecting identity by descent is present across the ~20 kb β-globin cluster including both embryonic (HBE) and adult (HBB) paralogs, though it was yet untested whether this is due to independent parallel evolution or adaptive introgression. In this study, we find that identical amino acid substitutions in the β-globin cluster that increase Hb-O₂ affinity have likely resulted from historical interbreeding between high-altitude populations of two different distantly-related species. We examined the direction of introgression and discovered that the species with a deeper mtDNA divergence that colonized high altitude earlier in history (Anas flavirostris) transferred adaptive genetic variation to the species with a shallower divergence (A. georgica) that likely colonized high altitude more recently possibly following a range shift into a novel environment. As a consequence, the species that received these β-globin variants through hybridization might have adapted to hypoxic conditions in the high-altitude environment more quickly through acquiring beneficial alleles from the standing, hybrid-origin variation, leading to faster evolution.

SUBMITTER: Graham AM

PROVIDER: S-EPMC8249413 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

DNA methylation patterns of β-globin cluster in β-thalassemia patients.

Project description:BackgroundReactivation of fetal hemoglobin (HbF, α2γ2) holds a therapeutic target for β-thalassemia and sickle cell disease. Although many HbF regulators have been identified, the methylation patterns in β-globin cluster driving the fetal-to-adult hemoglobin switch remains to be determined.ResultsHere, we evaluated DNA methylation patterns of the β-globin cluster from peripheral bloods of 105 β0/β0 thalassemia patients and 44 normal controls. We also recruited 15 bone marrows and 4 cord blood samples for further evaluation. We identified that the CpG sites in the locus control region (LCR) DNase I hypersensitive site 4 and 3 (HS4-3) regions, and γ- and β-globin promoters displayed hypomethylation in β0/β0-thalassemia patients, especially for the patients with high HbF level, as compared with normal controls. Furthermore, hypomethylations in most of CpG sites of the HS4-3 core regions were also observed in bone marrows (BM) of β0/β0-patients compared with normal controls; and methylation level of γ-globin promoter -50 and + 17 CpG sites showed lower methylation level in patients with high HbF level compared with those with low HbF level and a negative correlation with HbF level among β0-thalassemia patients. Finally, γ-globin promoter + 17 and + 50 CpG sites also displayed significant hypomethylation in cord blood (CB) tissues compared with BM tissues from normal controls.ConclusionsOur findings revealed methylation patterns in β-globin cluster associated with β0 thalassemia disease and γ-globin expression, contributed to understand the epigenetic modification in β0 thalassemia patients and provided candidate targets for the therapies of β-hemoglobinopathies.

| S-EPMC7712619 | biostudies-literature

Intergenic transcription in the human beta-globin gene cluster.

Project description:Our previous studies on nascent transcription across the human beta-globin gene cluster revealed the presence of intergenic transcripts in addition to the expected genic transcripts. We now show that transcription into the beta-globin locus control region (LCR) begins within an ERV9 endogenous retroviral long terminal repeat upstream of DNase I hypersensitive site 5. However, in a transgenic mouse, which has the human beta-globin LCR but lacks the ERV9 LTR, transcription begins upstream of the transgenic locus. We postulate that in this transgenic mouse nearby endogenous mouse promoters are activated by the LCR. Intergenic transcription is also detected across the whole transgenic globin gene locus independently of the stage of erythroid development. Intergenic transcription in the beta-globin cluster is erythroid specific; however, it can be induced in nonerythroid cells by several means: by transinduction with a plasmid transcribing part of the cluster, by exogenous addition of transcription factors, and by treatment with the histone deacetylase inhibitor trichostatin A.

| S-EPMC99797 | biostudies-literature

β-globin gene cluster haplotypes in ethnic minority populations of southwest China.

Project description:The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5' sites and 3' sites of the β-globin gene cluster. 5' haplotypes 2 (+---), 6 (-++-+), 9 (-++++) and 3' haplotype FW3 (-+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China.

| S-EPMC5311981 | biostudies-literature

Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.

Project description:β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

| S-EPMC10704694 | biostudies-literature

Z-DNA-forming sites within the human beta-globin gene cluster.

Project description:Agarose-encapsulated, metabolically active, permeabilized nuclei from human hematopoietic cell lines were tested for Z-DNA formation in the beta-globin gene cluster. Biotinylated monoclonal antibodies against Z-DNA were diffused into the nuclei and cross-linked to DNA with a 10-ns laser exposure at 266 nm. Following digestion with restriction enzymes, fragments that had formed Z-DNA were isolated. Seventeen regions with Z-DNA sequence motifs in the 73-kb region were studied by PCR amplification, and five were found in the Z conformation.

| S-EPMC40132 | biostudies-other

Cis-cotranscription of two beta globin genes during chicken primitive hematopoiesis.

Project description:Chicken beta globin locus contains four genes, two of which, rho and epsilon, are expressed from the earliest stage of primitive hematopoiesis. Here we show that the transcription of these two genes in the nucleus engages in "on/off" phases. During each "on" phase, cotranscription of rho and epsilon in cis is favored. We propose that these two chicken beta globin genes are transcribed not by competing for a transcription initiation complex, but in a cooperative way.

| S-EPMC1934934 | biostudies-literature

Adaptive introgression in Heliconius

Project description:Evolution of novel mimicry rings facilitated by adaptive introgression in tropical butterflies

| PRJEB21091 | ENA

Convergent changes in muscle metabolism depend on duration of high-altitude ancestry across Andean waterfowl.

Project description:High-altitude environments require that animals meet the metabolic O2 demands for locomotion and thermogenesis in O2-thin air, but the degree to which convergent metabolic changes have arisen across independent high-altitude lineages or the speed at which such changes arise is unclear. We examined seven high-altitude waterfowl that have inhabited the Andes (3812-4806 m elevation) over varying evolutionary time scales, to elucidate changes in biochemical pathways of energy metabolism in flight muscle relative to low-altitude sister taxa. Convergent changes across high-altitude taxa included increased hydroxyacyl-coA dehydrogenase and succinate dehydrogenase activities, decreased lactate dehydrogenase, pyruvate kinase, creatine kinase, and cytochrome c oxidase activities, and increased myoglobin content. ATP synthase activity increased in only the longest established high-altitude taxa, whereas hexokinase activity increased in only newly established taxa. Therefore, changes in pathways of lipid oxidation, glycolysis, and mitochondrial oxidative phosphorylation are common strategies to cope with high-altitude hypoxia, but some changes require longer evolutionary time to arise.

| S-EPMC7494360 | biostudies-literature

Inter-MAR association contributes to transcriptionally active looping events in human beta-globin gene cluster.

Project description:Matrix attachment regions (MARs) are important in chromatin organization and gene regulation. Although it is known that there are a number of MAR elements in the beta-globin gene cluster, it is unclear that how these MAR elements are involved in regulating beta-globin genes expression. Here, we report the identification of a new MAR element at the LCR (locus control region) of human beta-globin gene cluster and the detection of the inter-MAR association within the beta-globin gene cluster. Also, we demonstrate that SATB1, a protein factor that has been implicated in the formation of network like higher order chromatin structures at some gene loci, takes part in beta-globin specific inter-MAR association through binding the specific MARs. Knocking down of SATB1 obviously reduces the binding of SATB1 to the MARs and diminishes the frequency of the inter-MAR association. As a result, the ACH establishment and the alpha-like globin genes and beta-like globin genes expressions are affected either. In summary, our results suggest that SATB1 is a regulatory factor of hemoglobin genes, especially the early differentiation genes at least through affecting the higher order chromatin structure.

| S-EPMC2645683 | biostudies-literature

Archaic Adaptive Introgression in TBX15/WARS2.

Project description:A recent study conducted the first genome-wide scan for selection in Inuit from Greenland using single nucleotide polymorphism chip data. Here, we report that selection in the region with the second most extreme signal of positive selection in Greenlandic Inuit favored a deeply divergent haplotype that is closely related to the sequence in the Denisovan genome, and was likely introgressed from an archaic population. The region contains two genes, WARS2 and TBX15, and has previously been associated with adipose tissue differentiation and body-fat distribution in humans. We show that the adaptively introgressed allele has been under selection in a much larger geographic region than just Greenland. Furthermore, it is associated with changes in expression of WARS2 and TBX15 in multiple tissues including the adrenal gland and subcutaneous adipose tissue, and with regional DNA methylation changes in TBX15.

| S-EPMC5430617 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data