Characterization of Natural and Synthetic Sialoglycans Targeting the Hemagglutinin-Neuraminidase of Mumps Virus
Ontology highlight
ABSTRACT:
SUBMITTER: Forgione R
PROVIDER: S-EPMC8578797 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:Mumps virus is one of the main cause of respiratory illnesses in humans, especially children. Among the viral surface glycoproteins, the hemagglutinin - neuraminidase, MuV-HN, plays key roles in virus entry into host cells and infectivity, thus representing an ideal target for the design of novel inhibitors. Here we report the detailed analysis of the molecular recognition of host cell surface sialylated glycans by the viral glycoprotein MuV-HN. By a combined use of NMR, docking, molecular modelling and CORCEMA-ST, the structural features of sialoglycans/MuV-HN complexes were revealed. Evidence for a different enzyme activity toward longer and complex substrates compared to unbranched ligands was also examined by an accurate NMR kinetic analysis. Our results provide the basis for the structure-based design of effective drugs against mumps-induced diseases.
| S-EPMC6994497 | biostudies-literature
Project description:UnlabelledA bat virus with high phylogenetic relatedness to human mumps virus (MuV) was identified recently at the nucleic acid level. We analyzed the functional activities of the hemagglutinin-neuraminidase (HN) and the fusion (F) proteins of the bat virus (batMuV) and compared them to the respective proteins of a human isolate. Transfected cells expressing the F and HN proteins of batMuV were recognized by antibodies directed against these proteins of human MuV, indicating that both viruses are serologically related. Fusion, hemadsorption, and neuraminidase activities were demonstrated for batMuV, and either bat-derived protein could substitute for its human MuV counterpart in inducing syncytium formation when coexpressed in different mammalian cell lines, including chiropteran cells. Cells expressing batMuV glycoproteins were shown to have lower neuraminidase activity. The syncytia were smaller, and they were present in lower numbers than those observed after coexpression of the corresponding glycoproteins of a clinical isolate of MuV (hMuV). The phenotypic differences in the neuraminidase and fusion activity between the glycoproteins of batMuV and hMuV are explained by differences in the expression level of the HN and F proteins of the two viruses. In the case of the F protein, analysis of chimeric proteins revealed that the signal peptide of the bat MuV fusion protein is responsible for the lower surface expression. These results indicate that the surface glycoproteins of batMuV are serologically and functionally related to those of hMuV, raising the possibility of bats as a reservoir for interspecies transmission.ImportanceThe recently described MuV-like bat virus is unique among other recently identified human-like bat-associated viruses because of its high sequence homology (approximately 90% in most genes) to its human counterpart. Although it is not known if humans can be infected by batMuV, the antigenic relatedness between the bat and human forms of the virus suggests that humans carrying neutralizing antibodies against MuV are protected from infection by batMuV. The close functional relationship between MuV and batMuV is demonstrated by cooperation of the respective HN and F proteins to induce syncytium formation in heterologous expression studies. An interesting feature of the glycoproteins of batMuV is the downregulation of the fusion activity by the signal peptide of F, which has not been reported for other paramyxoviruses. These results are important contributions for risk assessment and for a better understanding of the replication strategy of batMuV.
| S-EPMC4442385 | biostudies-literature
Project description:A model is proposed for the three-dimensional structure of the paramyxovirus hemagglutinin-neuraminidase (HN) protein. The model is broadly similar to the structure of the influenza virus neuraminidase and is based on the identification of invariant amino acids among HN sequences which have counterparts in the enzyme-active center of influenza virus neuraminidase. The influenza virus enzyme-active site is constructed from strain-invariant functional and framework residues, but in this model of HN, it is primarily the functional residues, i.e., those that make direct contact with the substrate sialic acid, which have identical counterparts in neuraminidase. The framework residues of the active site are different in HN and in neuraminidase and appear to be less strictly conserved within HN sequences than within neuraminidase sequences.
| S-EPMC237633 | biostudies-other
Project description:Characterization of the epitopes on antigen recognized by monoclonal antibodies (mAb) is useful for the development of therapeutic antibodies, diagnostic tools, and vaccines. Epitope mapping also provides functional information for sequence-based repertoire analysis of antibody response to pathogen infection and/or vaccination. However, development of mapping strategies has lagged behind mAb discovery. We have developed a site-directed mutagenesis approach that can be used in conjunction with bio-layer interferometry (BLI) biosensors to map mAb epitopes. By generating a panel of single point mutants in the recombinant hemagglutinin (HA) and neuraminidase (NA) proteins of influenza A viruses, we have characterized the epitopes of hundreds of mAbs targeting the H1 and H3 subtypes of HA and the N9 subtype of NA.
| S-EPMC6416777 | biostudies-literature
Project description:Influenza A viruses (IAVs) occasionally cross the species barrier and adapt to novel host species. This requires readjustment of the functional balance of the sialic acid receptor-binding hemagglutinin (HA) and the receptor-destroying neuraminidase (NA) to the sialoglycan-receptor repertoire of the new host. Novel techniques have revealed mechanistic details of this HA-NA-receptor balance, emphasizing a previously underappreciated crucial role for NA in driving the motility of receptor-associated IAV particles. Motility enables virion penetration of the sialylated mucus layer as well as attachment to, and uptake into, underlying epithelial cells. As IAVs are essentially irreversibly bound in the absence of NA activity, the fine-tuning of the HA-NA-receptor balance rather than the binding avidity of IAV particles per se is an important factor in determining host species tropism.
| S-EPMC7172302 | biostudies-literature
Project description:BackgroundNewcastle disease virus (NDV) belongs to the genus Avaluvirus and Paramyxoviridae family, and it can cause acute, highly contagious Newcastle disease in poultry. The two proteins, haemagglutinin neuraminidase (HN) and Fusion (F), are the main virulence factor of the virus and play an essential role in immunogenicity against the virus. In most paramyxoviruses, the F protein requires HN protein to fuse the membrane, and HN proteins substantially enhance the viruses' fusion activity.ResultsThe present study describes the successful cloning and expression of HN protein from NDV in Bacillus subtilis WB800 using the modified shuttle vector pHT43. HN coding sequence was cloned into the pGet II vector. It was then subcloned into the PHT43 shuttle vector and transferred to Escherichia coli for replication. The recombinant plasmid was extracted from E. coli and used to transform B. subtilis by electroporation. After induction of recombinant B. subtilis by IPTG, total cell protein and the protein secreted into the media were analysed through a time course using SDS-PAGE. The expressed HN protein was purified using cation exchange chromatography followed by metal affinity chromatography, using the 6× His epitope introduced at the carboxyl terminus of the recombinant protein. The accuracy of the PHT43-HN construct was confirmed by sequencing and enzymatic digestion. SDS-PAGE results showed that the recombinant HN protein was successfully expressed and secreted into the medium. Moreover, the purified HN protein showed neuraminidase activity with characteristics similar to the indigenous HN NDV protein. B. subtilis is a free endotoxin host that could be a favourite prokaryotic platform for producing the recombinant HN protein.ConclusionThe establishment of this expression and purification system has allowed us to explore further the biochemical characteristics of HN protein and obtain material that could be suitable for a new production of NDV candidate vaccine with high immunogenicity.
| S-EPMC9130408 | biostudies-literature
Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.
| S-EPMC5993761 | biostudies-literature
Project description:Fifty-six Newcastle disease virus strains collected from 2000 to 2006 could be grouped into subgenotype VIId. However, they displayed cumulative mutations in and around the linear epitope of hemagglutinin-neuraminidase (residues 345 to 353) with time. The antigenicities of the variants that became predominant in Korea differ from each other and from the wild type.
| S-EPMC2292945 | biostudies-literature
Project description:Inhibition of neuraminidase (NA) activity prevents release of progeny virions from influenza-infected cells and removal of neuraminic (sialic) acid moieties from glycans attached to hemagglutinin (HA). Neuraminic acid moieties situated near the HA receptor-binding site can reduce the efficiency of virus binding and decrease viral dependence on NA activity for replication. With the use of reverse genetics technique, we investigated the effect of glycans attached at Asn 94a, 129, and 163 on the virus susceptibility to NA inhibitors in MDCK cells and demonstrated that the glycan attached at Asn 163 plays a dominant role in compensation for the loss of NA activity.
| S-EPMC1211522 | biostudies-literature
Project description:Paramyxoviruses cause a wide variety of human and animal diseases. They infect host cells using the coordinated action of two surface glycoproteins, the receptor binding protein (HN, H, or G) and the fusion protein (F). HN binds sialic acid on host cells (hemagglutinin activity) and hydrolyzes these receptors during viral egress (neuraminidase activity, NA). Additionally, receptor binding is thought to induce a conformational change in HN that subsequently triggers major refolding in homotypic F, resulting in fusion of virus and target cell membranes. HN is an oligomeric type II transmembrane protein with a short cytoplasmic domain and a large ectodomain comprising a long helical stalk and large globular head domain containing the enzymatic functions (NA domain). Extensive biochemical characterization has revealed that HN-stalk residues determine F specificity and activation. However, the F/HN interaction and the mechanisms whereby receptor binding regulates F activation are poorly defined. Recently, a structure of Newcastle disease virus (NDV) HN ectodomain revealed the heads (NA domains) in a "4-heads-down" conformation whereby two of the heads form a symmetrical interaction with two sides of the stalk. The interface includes stalk residues implicated in triggering F, and the heads sterically shield these residues from interaction with F (at least on two sides). Here we report the x-ray crystal structure of parainfluenza virus 5 (PIV5) HN ectodomain in a "2-heads-up/2-heads-down" conformation where two heads (covalent dimers) are in the "down position," forming a similar interface as observed in the NDV HN ectodomain structure, and two heads are in an "up position." The structure supports a model in which the heads of HN transition from down to up upon receptor binding thereby releasing steric constraints and facilitating the interaction between critical HN-stalk residues and F.
| S-EPMC3738495 | biostudies-literature