Browse
Submit Data
Databases
API
Help

Dataset Information

2 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

G4LDB 2.2: a database for discovering and studying G-quadruplex and i-Motif ligands.

ABSTRACT: Noncanonical nucleic acid structures, such as G-quadruplex (G4) and i-Motif (iM), have attracted increasing research interests because of their unique structural and binding properties, as well as their important biological activities. To date, thousands of small molecules that bind to varying G4/iM structures have been designed, synthesized and tested for diverse chemical and biological uses. Because of the huge potential and increasing research interests on G4-targeting ligands, we launched the first G4 ligand database G4LDB in 2013. Here, we report a new version, termed G4LDB 2.2 (http://www.g4ldb.com), with upgrades in both content and function. Currently, G4LDB2.2 contains >3200 G4/iM ligands, ∼28 500 activity entries and 79 G4-ligand docking models. In addition to G4 ligand library, we have also added a brand new iM ligand library to G4LDB 2.2, providing a comprehensive view of quadruplex nucleic acids. To further enhance user experience, we have also redesigned the user interface and optimized the database structure and retrieval mechanism. With these improvements, we anticipate that G4LDB 2.2 will serve as a comprehensive resource and useful research toolkit for researchers across wide scientific communities and accelerate discovering and validating better binders and drug candidates.

SUBMITTER: Wang YH

PROVIDER: S-EPMC8728129 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

The MHC Motif Atlas: a database of MHC binding specificities and ligands.

Project description:The highly polymorphic Major Histocompatibility Complex (MHC) genes are responsible for the binding and cell surface presentation of pathogen or cancer specific T-cell epitopes. This process is fundamental for eliciting T-cell recognition of infected or malignant cells. Epitopes displayed on MHC molecules further provide therapeutic targets for personalized cancer vaccines or adoptive T-cell therapy. To help visualizing, analyzing and comparing the different binding specificities of MHC molecules, we developed the MHC Motif Atlas (http://mhcmotifatlas.org/). This database contains information about thousands of class I and class II MHC molecules, including binding motifs, peptide length distributions, motifs of phosphorylated ligands, multiple specificities or links to X-ray crystallography structures. The database further enables users to download curated datasets of MHC ligands. By combining intuitive visualization of the main binding properties of MHC molecules together with access to more than a million ligands, the MHC Motif Atlas provides a central resource to analyze and interpret the binding specificities of MHC molecules.

| S-EPMC9825574 | biostudies-literature

A Luminescent 1D Silver Polymer Containing [2.2]Paracyclophane Ligands.

Project description:[2.2]Paracyclophane scaffolds have seen limited use as building blocks in supramolecular chemistry. Here, we report the synthesis and characterization of a 1D coordination polymer consisting of silver(I) ions bound to a [2.2]paracyclophane scaffold functionalized with two 4-pyridyl units. The structure of the polymer has been determined from single crystal X-ray diffraction analysis and reveals two different silver coordination motifs that alternate along the 1D coordination polymer. The coordination polymer exhibits strong blue and sky-blue fluorescence in solution and in the crystalline solid state, respectively.

| S-EPMC8371969 | biostudies-literature

Quadruplex Ligands in Cancer Therapy.

Project description:Nucleic acids can adopt alternative secondary conformations including four-stranded structures known as quadruplexes. To date, quadruplexes have been demonstrated to exist both in human chromatin DNA and RNA. In particular, quadruplexes are found in guanine-rich sequences constituting G-quadruplexes, and in cytosine-rich sequences forming i-Motifs as a counterpart. Quadruplexes are associated with key biological processes ranging from transcription and translation of several oncogenes and tumor suppressors to telomeres maintenance and genome instability. In this context, quadruplexes have prompted investigations on their possible role in cancer biology and the evaluation of small-molecule ligands as potential therapeutic agents. This review aims to provide an updated close-up view of the literature on quadruplex ligands in cancer therapy, by grouping together ligands for DNA and RNA G-quadruplexes and DNA i-Motifs.

| S-EPMC8267697 | biostudies-literature

Quadruplex ligands may act as molecular chaperones for tetramolecular quadruplex formation.

Project description:G-quadruplexes are a family of four-stranded DNA structures, stabilized by G-quartets, that form in the presence of monovalent cations. Efforts are currently being made to identify ligands that selectively bind to G-quadruplex motifs as these compounds may interfere with the telomere structure, telomere elongation/replication and proliferation of cancer cells. The kinetics of quadruplex-ligands interactions are poorly understood: it is not clear whether quadruplex ligands lock into the preformed structure (i.e. increase the lifetime of the structure by lowering the dissociation constant, k(off)) or whether ligands actively promote the formation of the complex and act as quadruplex chaperones by increasing the association constant, k(on). We studied the effect of a selective quadruplex ligand, a bisquinolinium pyridine dicarboxamide compound called 360A, to distinguish these two possibilities. We demonstrated that, in addition to binding to and locking into preformed quadruplexes, this molecule acted as a chaperone for tetramolecular complexes by acting on k(on). This observation has implications for in vitro and in vivo applications of quadruplexes and should be taken into account when evaluating the cellular responses to these agents.

| S-EPMC1885647 | biostudies-literature

Discovering ligands for a microRNA precursor with peptoid microarrays.

Project description:We have screened peptoid microarrays to identify specific ligands for the RNA hairpin precursor of miR-21, a microRNA involved in cancer and heart disease. Microarrays were printed by spotting a library of 7680 N-substituted oligoglycines (peptoids) onto glass slides. Two compounds on the array specifically bind RNA having the sequence and predicted secondary structure of the miR-21 precursor hairpin and have specific affinity for the target in solution. Their binding induces a conformational change around the hairpin loop, and the most specific compound recognizes the loop sequence and a bulged uridine in the proximal duplex. Functional groups contributing affinity and specificity were identified, and by varying a critical methylpyridine group, a compound with a dissociation constant of 1.9 microM for the miR-21 precursor hairpin and a 20-fold discrimination against a closely-related hairpin was created. This work describes a systematic approach to discovery of ligands for specific pre-defined novel RNA structures. It demonstrates discovery of new ligands for an RNA for which no specific lead compounds were previously known by screening a microarray of small molecules.

| S-EPMC2760809 | biostudies-other

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

| S-EPMC8835054 | biostudies-literature

Studying Mullerian duct anomalies - from cataloguing phenotypes to discovering causation.

Project description:Müllerian duct anomalies (MDAs) are developmental disorders of the Müllerian duct, the embryonic anlage of most of the female reproductive tract. The prevalence of MDAs is 6.7% in the general female population and 16.7% in women who exhibit recurrent miscarriages. Individuals affected by these anomalies suffer from high rates of infertility, first-trimester pregnancy losses, premature labour, placental retention, foetal growth retardation and foetal malpresentations. The aetiology of MDAs is complex and heterogeneous, displaying a range of clinical pictures that generally lack a direct genotype-phenotype correlation. De novo and familial cases sharing the same genomic lesions have been reported. The familial cases follow an autosomal-dominant inheritance, with reduced penetrance and variable expressivity. Furthermore, few genetic factors and molecular pathways underpinning Müllerian development and dysregulations causing MDAs have been identified. The current knowledge in this field predominantly derives from loss-of-function experiments in mouse and chicken models, as well as from human genetic association studies using traditional approaches, such as microarrays and Sanger sequencing, limiting the discovery of causal factors to few genetic entities from the coding genome. In this Review, we summarise the current state of the field, discuss limitations in the number of studies and patient samples that have stalled progress, and review how the development of new technologies provides a unique opportunity to overcome these limitations. Furthermore, we discuss how these new technologies can improve functional validation of potential causative alterations in MDAs.

| S-EPMC8246269 | biostudies-literature

A DNA G-quadruplex/i-motif hybrid.

Project description:DNA can form many structures beyond the canonical Watson-Crick double helix. It is now clear that noncanonical structures are present in genomic DNA and have biological functions. G-rich G-quadruplexes and C-rich i-motifs are the most well-characterized noncanonical DNA motifs that have been detected in vivo with either proscribed or postulated biological roles. Because of their independent sequence requirements, these structures have largely been considered distinct types of quadruplexes. Here, we describe the crystal structure of the DNA oligonucleotide, d(CCAGGCTGCAA), that self-associates to form a quadruplex structure containing two central antiparallel G-tetrads and six i-motif C-C+ base pairs. Solution studies suggest a robust structural motif capable of assembling as a tetramer of individual strands or as a dimer when composed of tandem repeats. This hybrid structure highlights the growing structural diversity of DNA and suggests that biological systems may harbor many functionally important non-duplex structures.

| S-EPMC7145706 | biostudies-literature

G4RNA: an RNA G-quadruplex database.

Project description:G-quadruplexes (G4) are tetrahelical structures formed from planar arrangement of guanines in nucleic acids. A simple, regular motif was originally proposed to describe G4-forming sequences. More recently, however, formation of G4 was discovered to depend, at least in part, on the contextual backdrop of neighboring sequences. Prediction of G4 folding is thus becoming more challenging as G4 outlier structures, not described by the originally proposed motif, are increasingly reported. Recent observations thus call for a comprehensive tool, capable of consolidating the expanding information on tested G4s, in order to conduct systematic comparative analyses of G4-promoting sequences. The G4RNA Database we propose was designed to help meet the need for easily-retrievable data on known RNA G4s. A user-friendly, flexible query system allows for data retrieval on experimentally tested sequences, from many separate genes, to assess G4-folding potential. Query output sorts data according to sequence position, G4 likelihood, experimental outcomes and associated bibliographical references. G4RNA also provides an ideal foundation to collect and store additional sequence and experimental data, considering the growing interest G4s currently generate.

| S-EPMC5630937 | biostudies-literature

Detection of CpG Methylation in G-Quadruplex Forming Sequences Using G-Quadruplex Ligands.

Project description:Genomic DNA methylation is involved in many diseases and is expected to be a specific biomarker for even the pre-symptomatic diagnosis of many diseases. Thus, a rapid and inexpensive detection method is required for disease diagnosis. We have previously reported that cytosine methylation in G-quadruplex (G4)-forming oligonucleotides develops different G4 topologies. In this study, we developed a method for detecting CpG methylation in G4-forming oligonucleotides based on the structural differences between methylated and unmethylated G4 DNAs. The differences in G4 topologies due to CpG methylation can be discriminated by G4 ligands. We performed a binding assay between methylated or unmethylated G4 DNAs and G4 ligands. The binding abilities of fluorescent G4 ligands to BCL-2, HRAS1, HRAS2, VEGF G4-forming sequences were examined by fluorescence-based microtiter plate assay. The differences in fluorescence intensities between methylated and unmethylated G4 DNAs were statistically significant. In addition to fluorescence detection, the binding of G4 ligand to DNA was detected by chemiluminescence. A significant difference was also detected in chemiluminescence intensity between methylated and unmethylated DNA. This is the first study on the detection of CpG methylation in G4 structures, focusing on structural changes using G4 ligands.

| S-EPMC8658440 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data