Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Accumulation dynamics of ARGONAUTE proteins during meiosis in Arabidopsis.

ABSTRACT: Meiosis is a specialized cell division that is key for reproduction and genetic diversity in sexually reproducing plants. Recently, different RNA silencing pathways have been proposed to carry a specific activity during meiosis, but the pathways involved during this process remain unclear. Here, we explored the subcellular localization of different ARGONAUTE (AGO) proteins, the main effectors of RNA silencing, during male meiosis in Arabidopsis thaliana using immunolocalizations with commercially available antibodies. We detected the presence of AGO proteins associated with posttranscriptional gene silencing (AGO1, 2, and 5) in the cytoplasm and the nucleus, while AGOs associated with transcriptional gene silencing (AGO4 and 9) localized exclusively in the nucleus. These results indicate that the localization of different AGOs correlates with their predicted roles at the transcriptional and posttranscriptional levels and provide an overview of their timing and potential role during meiosis.

SUBMITTER: Oliver C

PROVIDER: S-EPMC9110482 | biostudies-literature | 2022 Jun

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Accumulation dynamics of ARGONAUTE proteins during meiosis in Arabidopsis.

Oliver Cecilia C Martinez German G

Plant reproduction 20211123 2

Meiosis is a specialized cell division that is key for reproduction and genetic diversity in sexually reproducing plants. Recently, different RNA silencing pathways have been proposed to carry a specific activity during meiosis, but the pathways involved during this process remain unclear. Here, we explored the subcellular localization of different ARGONAUTE (AGO) proteins, the main effectors of RNA silencing, during male meiosis in Arabidopsis thaliana using immunolocalizations with commerciall ...[more]

PMID: 34812935

Similar Datasets

On the role of some ARGONAUTE proteins in meiosis and DNA repair in Arabidopsis thaliana.

Project description:In plants, small non-coding RNAs (≈20-30 nt) play a major role in a gene regulation mechanism that controls development, maintains heterochromatin and defends against viruses. However, their possible role in cell division (mitosis and meiosis) still remains to be ascertained. ARGONAUTE (AGO) proteins are key players in the different small RNA (sRNA) pathways. Arabidopsis contains 10 AGO proteins belonging to three distinct phylogenetic clades based on amino acid sequence, namely: AGO1/AGO5/AGO10, AGO2/AGO3/AGO7, and AGO4/AGO6/AGO8/AGO9. To gain new insights into the role of AGO proteins, we have focused our attention on AGO2, AGO5, and AGO9 by means of the analysis of plants carrying mutations in the corresponding genes. AGO2 plays a role in the natural cis-antisense (nat-siRNA) pathway and is required for an efficient DNA repair. On the other hand, AGO5, involved in miRNA (microRNA)-directed target cleavage, and AGO9, involved in RNA-directed DNA methylation (RdDM), are highly enriched in germline. On these grounds, we have analyzed the effects of these proteins on the meiotic process and also on DNA repair. It was confirmed that AGO2 is involved in DNA repair. In ago2-1 the mean cell chiasma frequency in pollen mother cells (PMCs) was increased relative to the wild-type (WT). ago5-4 showed a delay in germination time and a slight decrease in fertility, however the meiotic process and chiasma levels were normal. Meiosis in PMCs of ago9-1 was characterized by a high frequency of chromosome interlocks from pachytene to metaphase I, but chiasma frequency and fertility were normal. Genotoxicity assays have confirmed that AGO9 is also involved in somatic DNA repair.

| S-EPMC4033075 | biostudies-literature

Roles and programming of Arabidopsis ARGONAUTE proteins during Turnip mosaic virus infection.

Project description:In eukaryotes, ARGONAUTE proteins (AGOs) associate with microRNAs (miRNAs), short interfering RNAs (siRNAs), and other classes of small RNAs to regulate target RNA or target loci. Viral infection in plants induces a potent and highly specific antiviral RNA silencing response characterized by the formation of virus-derived siRNAs. Arabidopsis thaliana has ten AGO genes of which AGO1, AGO2, and AGO7 have been shown to play roles in antiviral defense. A genetic analysis was used to identify and characterize the roles of AGO proteins in antiviral defense against Turnip mosaic virus (TuMV) in Arabidopsis. AGO1, AGO2 and AGO10 promoted anti-TuMV defense in a modular way in various organs, with AGO2 providing a prominent antiviral role in leaves. AGO5, AGO7 and AGO10 had minor effects in leaves. AGO1 and AGO10 had overlapping antiviral functions in inflorescence tissues after systemic movement of the virus, although the roles of AGO1 and AGO10 accounted for only a minor amount of the overall antiviral activity. By combining AGO protein immunoprecipitation with high-throughput sequencing of associated small RNAs, AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. These findings indicate that distinct AGO proteins function as antiviral modules, and provide a molecular explanation for the silencing suppressor activity of HC-Pro.

| S-EPMC4373807 | biostudies-literature

The interplay of RecA-related proteins and the MND1-HOP2 complex during meiosis in Arabidopsis thaliana.

Project description:During meiosis, homologous chromosomes recognize each other, align, and exchange genetic information. This process requires the action of RecA-related proteins Rad51 and Dmc1 to catalyze DNA strand exchanges. The Mnd1-Hop2 complex has been shown to assist in Dmc1-dependent processes. Furthermore, higher eukaryotes possess additional RecA-related proteins, like XRCC3, which are involved in meiotic recombination. However, little is known about the functional interplay between these proteins during meiosis. We investigated the functional relationship between AtMND1, AtDMC1, AtRAD51, and AtXRCC3 during meiosis in Arabidopsis thaliana. We demonstrate the localization of AtMND1 to meiotic chromosomes, even in the absence of recombination, and show that AtMND1 loading depends exclusively on AHP2, the Arabidopsis Hop2 homolog. We provide evidence of genetic interaction between AtMND1, AtDMC1, AtRAD51, and AtXRCC3. In vitro assays suggest that this functional link is due to direct interaction of the AtMND1-AHP2 complex with AtRAD51 and AtDMC1. We show that AtDMC1 foci accumulate in the Atmnd1 mutant, but are reduced in number in Atrad51 and Atxrcc3 mutants. This study provides the first insights into the functional differences of AtRAD51 and AtXRCC3 during meiosis, demonstrating that AtXRCC3 is dispensable for AtDMC1 focus formation in an Atmnd1 mutant background, whereas AtRAD51 is not. These results clarify the functional interactions between key players in the strand exchange processes during meiotic recombination. Furthermore, they highlight a direct interaction between MND1 and RAD51 and show a functional divergence between RAD51 and XRCC3.

| S-EPMC2014788 | biostudies-literature

Meiosis-associated argonaute (MAGO) proteins are necessary for meiosis in maize

Project description:Plants do not specify their germline until late in their life cycle. Hence, the plant germline is normally specified from terminally differentiated somatic cells, though the precise mechanism(s) are unknown. We have found that male gametogenesis in maize is associated with the accumulation of distinct 21-nt phased small-interfering RNAs (phasiRNAs) generated by meiosis-associated argonaute (MAGO) proteins. MAGO1 accumulates in the epidermis of pre-meiotic anthers while MAGO2 is found in developing meiocytes. We have found that MAGO proteins are required for meiocyte development as mutants display chromosomal defects and male infertility. Furthermore, we detect the heat stress-induced activation of a distinct class of Long terminal repeat retrotransposons in the male germline of MAGO mutants. Our data suggests that MAGO proteins and the reproductive phasiRNAs play important roles protecting the germline from transposable elements during environmental stress conditions.

2022-01-04 | PXD013891 | Pride

Accumulation of Securin on Spindle During Female Meiosis I.

Project description:Chromosome segregation during female meiosis is frequently incorrect with severe consequences including termination of further development or severe disorders, such as Down syndrome. Accurate chromosome segregation requires tight control of a protease called separase, which facilitates the separation of sister chromatids by cohesin cleavage. There are several control mechanisms in place, including the binding of specific protein inhibitor securin, phosphorylation by cyclin-dependent kinase 1 (CDK1), and complex with SGO2 and MAD2 proteins. All these mechanisms restrict the activation of separase for the time when all chromosomes are properly attached to the spindle. In our study, we focused on securin and compared the expression profile of endogenous protein with exogenous securin, which is widely used to study chromosome segregation. We also compared the dynamics of securin proteolysis in meiosis I and meiosis II. Our study revealed that the expression of both endogenous and exogenous securin in oocytes is compartmentalized and that this protein accumulates on the spindle during meiosis I. We believe that this might have a direct impact on the regulation of separase activity in the vicinity of the chromosomes.

| S-EPMC8358270 | biostudies-literature

Genome-wide computational identification of WG/GW Argonaute-binding proteins in Arabidopsis.

Project description:Domains in Arabidopsis proteins NRPE1 and SPT5-like, composed almost exclusively of repeated motifs in which only WG or GW sequences and an overall amino-acid preference are conserved, have been experimentally shown to bind multiple molecules of Argonaute (AGO) protein(s). Domain swapping between the WG/GW domains of NRPE1 and the human protein GW182 showed a conserved function. As classical sequence alignment methods are poorly-adapted to detect such weakly-conserved motifs, we have developed a tool to carry out a systematic analysis to identify genes potentially encoding AGO-binding GW/WG proteins. Here, we describe exhaustive analysis of the Arabidopsis genome for all regions potentially encoding proteins bearing WG/GW motifs and consider the possible role of some of them in AGO-dependent mechanisms. We identified 20 different candidate WG/GW genes, encoding proteins in which the predicted domains range from 92aa to 654aa. These mostly correspond to a limited number of families: RNA-binding proteins, transcription factors, glycine-rich proteins, translation initiation factors and known silencing-associated proteins such as SDE3. Recent studies have argued that the interaction between WG/GW-rich domains and AGO proteins is evolutionarily conserved. Here, we demonstrate by an in silico domain-swapping simulation between plant and mammalian WG/GW proteins that the biased amino-acid composition of the AGO-binding sites is conserved.

| S-EPMC2910046 | biostudies-literature

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

2015-04-06 | GSE64911 | GEO

AtMND1 is required for homologous pairing during meiosis in Arabidopsis.

Project description:BackgroundPairing of homologous chromosomes at meiosis is an important requirement for recombination and balanced chromosome segregation among the products of meiotic division. Recombination is initiated by double strand breaks (DSBs) made by Spo11 followed by interaction of DSB sites with a homologous chromosome. This interaction requires the strand exchange proteins Rad51 and Dmc1 that bind to single stranded regions created by resection of ends at the site of DSBs and promote interactions with uncut DNA on the homologous partner. Recombination is also considered to be dependent on factors that stabilize interactions between homologous chromosomes. In budding yeast Hop2 and Mnd1 act as a complex to promote homologous pairing and recombination in conjunction with Rad51 and Dmc1.ResultsWe have analyzed the function of the Arabidopsis orthologue of the budding yeast MND1 gene (AtMND1). Loss of AtMND1 did not affect normal vegetative development but caused fragmentation and missegregation of chromosomes in male and female meiosis, formation of inviable gametes, and sterility. Analysis of the Atmnd1 Atspo11-1 double mutant indicated that chromosome fragmentation in Atmnd1 was suppressed by loss of Atspo11-1. Fluorescence in situ hybridization (FISH) analysis showed that homologous pairing failed to occur and homologues remained apart throughout meiosis. AtMND1 showed strong expression in meiocytes as revealed by RNA in situs.ConclusionWe conclude that AtMND1 is required for homologous pairing and is likely to play a role in the repair of DNA double strand breaks during meiosis in Arabidopsis, thus showing conservation of function with that of MND1 during meiosis in yeast.

| S-EPMC1557525 | biostudies-literature

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Meiosis in allopolyploid Arabidopsis suecica.

Project description:Polyploidy is a major force shaping eukaryote evolution but poses challenges for meiotic chromosome segregation. As a result, first-generation polyploids often suffer from more meiotic errors and lower fertility than established wild polyploid populations. How established polyploids adapt their meiotic behaviour to ensure genome stability and accurate chromosome segregation remains an active research question. We present here a cytological description of meiosis in the model allopolyploid species Arabidopsis suecica (2n = 4x = 26). In large part meiosis in A. suecica is diploid-like, with normal synaptic progression and no evidence of synaptic partner exchanges. Some abnormalities were seen at low frequency, including univalents at metaphase I, anaphase bridges and aneuploidy at metaphase II; however, we saw no evidence of crossover formation occurring between non-homologous chromosomes. The crossover number in A. suecica is similar to the combined number reported from its diploid parents Arabidopsis thaliana (2n = 2x = 10) and Arabidopsis arenosa (2n = 2x = 16), with an average of approximately 1.75 crossovers per chromosome pair. This contrasts with naturally evolved autotetraploid A. arenosa, where accurate chromosome segregation is achieved by restricting crossovers to approximately 1 per chromosome pair. Although an autotetraploid donor is hypothesized to have contributed the A. arenosa subgenome to A. suecica, A. suecica harbours diploid A. arenosa variants of key meiotic genes. These multiple lines of evidence suggest that meiosis in the recently evolved allopolyploid A. suecica is essentially diploid like, with meiotic adaptation following a very different trajectory to that described for autotetraploid A. arenosa.

| S-EPMC9545853 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data