Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Identification of dinR, a DNA damage-inducible regulator gene of Bacillus subtilis.

ABSTRACT: A Bacillus subtilis strain deficient in homologous recombination was isolated from a library of Tn917lac insertion mutants. The interrupted locus consists of an open reading frame encoding a 22,823-dalton polypeptide. Analysis of the deduced amino acid sequence revealed 34% identity and 47.3% similarity with the LexA protein from Escherichia coli. The gene was designated dinR. It is located between the recA and thyA genetic markers, at 162 degrees on the B. subtilis chromosome. The dinR gene was shown to be expressed during the entire B. subtilis cellular cycle with at least a threefold increase when cells develop competence. In addition, the use of a merodiploid strain, in which a copy of the wild-type dinR gene coexists with a dinR-lacZ transcriptional fusion, demonstrated that dinR is an SOS gene and that the SOS-induced expression of dinR occurred only when a wild-type copy of dinR was present. In addition, DinR seems to regulate the expression of dinC, another SOS gene.

SUBMITTER: Raymond-Denise A

PROVIDER: S-EPMC209213 | biostudies-other | 1991 Nov

REPOSITORIES: biostudies-other

ACCESS DATA

Json Xml

Publications

Identification of dinR, a DNA damage-inducible regulator gene of Bacillus subtilis.

Raymond-Denise A A Guillen N N

Journal of bacteriology 19911101 22

A Bacillus subtilis strain deficient in homologous recombination was isolated from a library of Tn917lac insertion mutants. The interrupted locus consists of an open reading frame encoding a 22,823-dalton polypeptide. Analysis of the deduced amino acid sequence revealed 34% identity and 47.3% similarity with the LexA protein from Escherichia coli. The gene was designated dinR. It is located between the recA and thyA genetic markers, at 162 degrees on the B. subtilis chromosome. The dinR gene was ...[more]

PMID: 1657879

Similar Datasets

Genes important for DNA damage response in Bacillus subtilis

Project description:The objective of the experiments was to identify non-essential genes required for mitigating the response DNA damage

2018-06-27 | GSE109366 | GEO

Bacillus subtilis RarA forms damage-inducible foci that scan the entire cell.

Project description:OBJECTIVES:Little is known about the activity and dynamics of ATPase RarA in B. subtilis, proposed to act at stalled DNA replication forks due to DNA damage. We performed fluorescence microscopy time lapse experiments with a functional RarA-mVenus fusion to visualize the dynamics of RarA during conditions that generate DNA damage. DATA DESCRIPTION:In exponentially growing cells, we observed that 15% of the cells contained single RarA-mV (mVenus fluorescent fusion) foci moving throughout the entire cell between 3 min intervals. This percentage remained constant at different time points, indicating that focus formation during unperturbed growth is maintained at about a constant rate. When cells were exposed to stress conditions, the population of cells containing RarA-mV foci tripled after 60 min. Cells exposed to two DNA-damaging drugs, to 5 mM MMS or to 0.5 mM H2O2, showed a similar type of response, with RarA-mVenus foci moving more slowly than during unperturbed growth. It is likely that RarA-mV contributes to the repair of H2O2-induced lesions, and to a minor extent to MMS-induced lesions. The presence of foci in growing cells suggests that RarA also plays a role during the cell cycle, at least in a fraction of cells, possibly contributing to heterogeneity of response to DNA damage.

| S-EPMC6458690 | biostudies-other

Phosphorylation of Bacillus subtilis gene regulator AbrB modulates its DNA-binding properties

Project description:AbrB is a global gene regulator involved in transition phase phenomena in Bacillus subtilis. It participates in a complex regulatory network governing the expression of stationary phase functions. AbrB was previously found to be phosphorylated on serine 86 located close to its C-terminal oligomerization domain. Here we report that AbrB can be phosphorylated by three B. subtilis serine/threonine kinases expressed during the transition and stationary phase: PrkC, PrkD and YabT. Our in vitro findings suggest that AbrB phosphorylation impedes its DNA binding and abolishes binding cooperativity. In vivo we established that a phospho-mimetic mutation abrB S86D leads to a significant loss of AbrB control over several key target functions: exoprotease production, competence development and sporulation. A wider transcriptome analysis of abrB S86D and S86A mutant strains revealed deregulation of a large number of target genes. We therefore propose that AbrB phosphorylation serves as an additional input for fine-tuning the activity of this ambiactive gene regulator.

2014-04-11 | GSE56723 | GEO

Phosphorylation of Bacillus subtilis gene regulator AbrB modulates its DNA-binding properties

2014-04-11 | E-GEOD-56723 | biostudies-arrayexpress

Bacillus subtilis alkA gene encoding inducible 3-methyladenine DNA glycosylase is adjacent to the ada operon.

Project description:In Bacillus subtilis, the adaptive response to DNA alkylation depends on the ada operon, which consists of the adaA and adaB genes, which encode methylphosphotriester DNA methyltransferase (AdaA protein) and O6-methylguanine DNA methyltransferase (AdaB protein), respectively. A structural gene (alkA) that encodes 3-methyladenine DNA glycosylase was found upstream of the ada operon, but in the opposite orientation. This cluster of genes was mapped at about 235 kb from the SfiI recognition site near the origin of replication in the physical map of the B. subtilis chromosome. Disruption of the alkA gene sensitized cells to N-propyl-N'-nitro-N-nitrosoguanidine, while its overproduction rendered cells highly resistant to N-propyl-N'-nitro-N-nitrosoguanidine, indicating that lethal DNA damage produced by bulky alkylating agents was effectively counteracted by AlkA glycosylase. Transcription of the alkA gene was induced by treating adaA+ cells with methylating agents concurrent with transcription of the ada operon. This was accomplished by using methylated AdaA protein bound to a 30-bp segment in the middle of the 100-bp sequence between the transcriptional start sites of the alkA gene and ada operon. Thus, in this organism, the adaptive response to DNA alkylation is achieved by autologous activation of a divergent regulon composed of the genes for a DNA glycosylase and two species of DNA alkyltransferase.

| S-EPMC206683 | biostudies-other

Functional dissection of YabA, a negative regulator of DNA replication initiation in Bacillus subtilis.

Project description:The regulation of initiation of DNA replication is crucial to ensure that the genome is replicated only once per cell cycle. In the Gram-positive bacterium Bacillus subtilis, the function of the YabA protein in initiation control was assigned based on its interaction with the DnaA initiator and the DnaN sliding clamp in the yeast two-hybrid and on the overinitiation phenotype observed in a yabA null strain. However, YabA is unrelated to known regulators of initiation and interacts with several additional proteins that could also be involved directly or not in initiation control. Here, we investigated the specific role of YabA interactions with DnaA and DnaN in initiation control by identifying single amino acid changes in YabA that disrupted solely the interaction with DnaA or DnaN. These disruptive mutations delineated specific interacting surfaces involving a Zn2+-cluster structure in YabA. In B. subtilis, these YabA interaction mutations abolished both initiation control and the formation of YabA foci at the replication factory. Upon coexpression of deficient YabA mutants, mixed oligomers formed foci at the replisome and restored initiation control, indicating that YabA acts within a heterocomplex with DnaA and DnaN. In agreement, purified YabA oligomerized and formed complexes with DnaA and DnaN. These findings underscore the functional association of YabA with the replication machinery, indicating that YabA regulates initiation through coupling with the elongation of replication.

| S-EPMC1413692 | biostudies-literature

DNA polymerase III gene of Bacillus subtilis.

Project description:The Bacillus subtilis dnaF (polC) gene that codes for the alpha subunit of the DNA polymerase III holoenzyme has been sequenced. It consists of 4005 base pairs coding for 1335 amino acids (from the start to the stop codon), giving a molecular weight of 151,273. A mutation (azp-12) that confers resistance to the antimicrobial drug 6-(p-hydroxyphenylazo)-uracil is due to a single base change at nucleotide 3523, from TCA to GCA, resulting in a change of the 1175th amino acid, serine, to alanine. It is in the active site and located at the C-terminal part of the enzyme. The amino acid composition in an N-terminal domain has 26% homology to the epsilon subunit coded by the dnaQ gene of Escherichia coli, which is a 3'----5' proofreading exonuclease, supporting an earlier observation that this function is an integral part of the polymerase molecule in B. subtilis.

| S-EPMC287281 | biostudies-other

A compartmentalized regulator of developmental gene expression in Bacillus subtilis.

Project description:We have identified a new Bacillus subtilis gene, spoVT, whose gene product is homologous to the transcriptional regulator AbrB and serves as a regulator of E sigmaG-controlled gene expression. SpoVT acts both positively and negatively in controlling sigmaG-dependent gene expression, providing an additional level of refinement to forespore gene regulation and feedback control of spoIIIG expression.

| S-EPMC178216 | biostudies-other

Bacillus subtilis utilizes the DNA damage response to manage multicellular development.

Project description:Bacteria switch between free-living and a multicellular state, known as biofilms, in response to cellular and environmental cues. It is important to understand how these cues influence biofilm development as biofilms are not only ubiquitous in nature but are also causative agents of infectious diseases. It is often believed that any stress triggers biofilm formation as a means of bacterial protection. In this study, we propose a new mechanism for how cellular and environmental DNA damage may influence biofilm formation. We demonstrate that Bacillus subtilis prevents biofilm formation and cell differentiation when stressed by oxidative DNA damage. We show that during B. subtilis biofilm development, a subpopulation of cells accumulates reactive oxygen species, which triggers the DNA damage response. Surprisingly, DNA damage response induction shuts off matrix genes whose products permit individual cells to stick together within a biofilm. We further revealed that DDRON cells and matrix producers are mutually exclusive and spatially separated within the biofilm, and that a developmental checkpoint protein, Sda, mediates the exclusiveness. We believe this represents an alternative survival strategy, ultimately allowing cells to escape the multicellular community when in danger.

| S-EPMC5445613 | biostudies-other

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

Project description:The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.

| S-EPMC3889614 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data