Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Defining genes: a computational framework.

ABSTRACT: The precise elucidation of the gene concept has become the subject of intense discussion in light of results from several, large high-throughput surveys of transcriptomes and proteomes. In previous work, we proposed an approach for constructing gene concepts that combines genomic heritability with elements of function. Here, we introduce a definition of the gene within a computational framework of cellular interactions. The definition seeks to satisfy the practical requirements imposed by annotation, capture logical aspects of regulation, and encompass the evolutionary property of homology.

SUBMITTER: Stadler PF

PROVIDER: S-EPMC2766041 | biostudies-other | 2009 Aug

REPOSITORIES: biostudies-other

ACCESS DATA

Json Xml

Similar Datasets

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress

A robust experimental and computational framework analysis at multiple resolutions, modalities and coverages

Project description:We assessed the utilities of integrating four advanced sequencing and multiplex imaging technologies to study cancer-immune cell interactions. These four technologies include single-cell RNA sequencing and Spatial Transcriptomic (both measuring over >20,000 genes), RNA In Situ Hybridization (multiplex 4-12 genes) and Opal multiplex protein staining (4-9 proteins). We evaluated the approach to discover and validate cell-cell interaction in situ through in-depth analysis of two types of cancer, basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), which account for over 70% of skin cancer cases.

2022-07-26 | E-MTAB-11932 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

A Computational Framework Based on Ensemble Deep Neural Networks for Essential Genes Identification.

Project description:Essential genes contain key information of genomes that could be the key to a comprehensive understanding of life and evolution. Because of their importance, studies of essential genes have been considered a crucial problem in computational biology. Computational methods for identifying essential genes have become increasingly popular to reduce the cost and time-consumption of traditional experiments. A few models have addressed this problem, but performance is still not satisfactory because of high dimensional features and the use of traditional machine learning algorithms. Thus, there is a need to create a novel model to improve the predictive performance of this problem from DNA sequence features. This study took advantage of a natural language processing (NLP) model in learning biological sequences by treating them as natural language words. To learn the NLP features, a supervised learning model was consequentially employed by an ensemble deep neural network. Our proposed method could identify essential genes with sensitivity, specificity, accuracy, Matthews correlation coefficient (MCC), and area under the receiver operating characteristic curve (AUC) values of 60.2%, 84.6%, 76.3%, 0.449, and 0.814, respectively. The overall performance outperformed the single models without ensemble, as well as the state-of-the-art predictors on the same benchmark dataset. This indicated the effectiveness of the proposed method in determining essential genes, in particular, and other sequencing problems, in general.

| S-EPMC7730808 | biostudies-literature

Computational derivation of a molecular framework for hair follicle biology from disease genes.

Project description:Knowledge about genetic drivers of disease increases the efficiency of interpreting patient DNA sequence and helps to identify and prioritize biological points of intervention. Discoveries of genes with single mutations exerting substantial phenotypic impact reliably provide new biological insight, although such approaches tend to generate knowledge that is disjointed from the complexity of biological systems governed by elaborate networks. Here we sought to facilitate diagnostic sequencing for hair disorders and assess the underlying biology by compiling an archive of 684 genes discovered in studies of monogenic disorders and identifying molecular annotations enriched by them. To demonstrate utility for this dataset, we performed two data driven analyses. First, we extracted and analyzed data implicating enriched signaling pathways and identified previously unrecognized contributions from Hippo signaling. Second, we performed hierarchical clustering on the entire dataset to investigate the underlying causal structure of hair disorders. We identified 35 gene clusters representing genetically derived biological modules that provide a foundation for the development of a new disease taxonomy grounded in biology, rather than clinical presentations alone. This Resource will be useful for diagnostic sequencing in patients with diseases affecting the hair follicle, improved characterization of hair follicle biology, and methods development in precision medicine.

| S-EPMC5701154 | biostudies-literature

Computational framework for predictive biodegradation.

Project description:As increasing amounts of anthropogenic chemicals are released into the environment, it is vital to human health and the preservation of ecosystems to evaluate the fate of these chemicals in the environment. It is useful to predict whether a particular compound is biodegradable and if alternate routes can be engineered for compounds already known to be biodegradable. In this work, we describe a computational framework (called BNICE) that can be used for the prediction of novel biodegradation pathways of xenobiotics. The framework was applied to 4-chlorobiphenyl, phenanthrene, gamma-hexachlorocyclohexane, and 1,2,4-trichlorobenzene, compounds representing various classes of xenobiotics with known biodegradation routes. BNICE reproduced the proposed biodegradation routes found experimentally, and in addition, it expanded the biodegradation reaction networks through the generation of novel compounds and reactions. The novel reactions involved in the biodegradation of 1,2,4-trichlorobenzene were studied in depth, where pathway and thermodynamic analyses were performed. This work demonstrates that BNICE can be applied to generate novel pathways to degrade xenobiotic compounds that are thermodynamically feasible alternatives to known biodegradation routes and attractive targets for metabolic engineering.

| S-EPMC4073782 | biostudies-literature

SPaRTAN, a computational framework for linking cell-surface receptors to transcriptional regulators

Project description:The identity and functions of specialized cell types are dependent on the complex interplay between signaling and transcriptional networks. Recently single-cell technologies such as CITE-seq have been developed that enable simultaneous quantitative analysis of cell-surface receptor expression with transcriptional states. To date, these datasets have not been used to systematically develop cell-context-specific maps of the interface between signaling and transcriptional regulators orchestrating cellular identity and function. We present SPaRTAN (Single-cell Proteomic and RNA based Transcription factor Activity Network), a computational method to link cell-surface receptors to transcription factors (TFs) by exploiting cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) datasets with cis-regulatory information. SPaRTAN is applied to immune cell types in the blood to predict the coupling of signaling receptors with cell context-specific TFs. The predictions are validated by prior knowledge and flow cytometry analyses. SPaRTAN is then used to predict the signaling coupled TF states of tumor infiltrating CD8+ T cells in malignant peritoneal and pleural mesotheliomas. SPaRTAN greatly enhances the utility of CITE-seq datasets to uncover TF and cell-surface receptor relationships in diverse cellular states.

2021-08-16 | GSE172155 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the SubSeries listed below.

2009-06-03 | GSE14696 | GEO

Computational screen for spliceosomal RNA genes aids in defining the phylogenetic distribution of major and minor spliceosomal components.

Project description:The RNA molecules of the spliceosome are critical for specificity and catalysis during splicing of eukaryotic pre-mRNA. In order to examine the evolution and phylogenetic distribution of these RNAs, we analyzed 149 eukaryotic genomes representing a broad range of phylogenetic groups. RNAs were predicted using high-sensitivity local alignment methods and profile HMMs in combination with covariance models. The results provide the most comprehensive view so far of the phylogenetic distribution of spliceosomal RNAs. RNAs were predicted in many phylogenetic groups where these RNA were not previously reported. Examples are RNAs of the major (U2-type) spliceosome in all fungal lineages, in lower metazoa and many protozoa. We also identified the minor (U12-type) spliceosomal U11 and U6atac RNAs in Acanthamoeba castellanii, where U12 spliceosomal RNA as well as minor introns were reported recently. In addition, minor-spliceosome-specific RNAs were identified in a number of phylogenetic groups where previously such RNAs were not observed, including the nematode Trichinella spiralis, the slime mold Physarum polycephalum and the fungal lineages Zygomycota and Chytridiomycota. The detailed map of the distribution of the U12-type RNA genes supports an early origin of the minor spliceosome and points to a number of occasions during evolution where it was lost.

| S-EPMC2396436 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data