Browse
Submit Data
Databases
API
Help

Dataset Information

10 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Structure and expression of the hairless gene of mice.

ABSTRACT: The hairless mutation of mice was caused by insertion of a murine leukemia virus. Starting with sequences flanking the provirus, a series of overlapping clones surrounding the viral integration site were obtained. By using a combination of sequencing, PCR, and exon-trapping techniques, the hairless gene was identified. It encodes a predicted protein of 1182 amino acids, including a potential zinc-finger domain. The expression patterns of the gene closely reflect the phenotype of animals carrying the hairless mutation.

SUBMITTER: Cachon-Gonzalez MB

PROVIDER: S-EPMC44473 | biostudies-other | 1994 Aug

REPOSITORIES: biostudies-other

ACCESS DATA

Json Xml

Publications

Structure and expression of the hairless gene of mice.

Cachon-Gonzalez M B MB Fenner S S Coffin J M JM Moran C C Best S S Stoye J P JP

Proceedings of the National Academy of Sciences of the United States of America 19940801 16

The hairless mutation of mice was caused by insertion of a murine leukemia virus. Starting with sequences flanking the provirus, a series of overlapping clones surrounding the viral integration site were obtained. By using a combination of sequencing, PCR, and exon-trapping techniques, the hairless gene was identified. It encodes a predicted protein of 1182 amino acids, including a potential zinc-finger domain. The expression patterns of the gene closely reflect the phenotype of animals carrying ...[more]

PMID: 8052649

Similar Datasets

Red Light Modulates Ultraviolet-Induced Gene Expression in the Epidermis of Hairless Mice.

Project description:The purpose of this study was to investigate whether low-level light therapy (LLLT) was capable of modulating expression of ultraviolet (UV) light-responsive genes in vivo.The effects of 670?nm light-emitting diode (LED) array irradiation were investigated in a hairless SHK-1 mouse epidermis model. Mice were given a single dose of UVA/UVB light, or three doses of red light (670?nm @ 8?mW/cm(2) x 312?sec, 2.5?J/cm(2) per session) spread over 24?h along with combinations of pre- and post-UV treatment with red light. Levels of 14?UV-responsive mRNAs were quantified 24?h after UV irradiation by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR).The transcription of mRNAs encoding for cluster of differentiation molecule 11b (CD11b) (p?<?0.05) and interferon (IFN)-? (p?<?0.012) increased after irradiation with red light alone, whereas expression level of cyclooxygenase (COX)-2 (p?<?0.02) was downregulated. Genes unresponsive to UV did not change their expression levels after exposure to red light either. Pretreatment with red light significantly modified response of Fos to UV exposure (p?<?0.01). A synergy of UV and post-treatment with red light in reducing the transcription levels of CD11b (p?<?0.05) and inducible nitric oxide synthase (iNOS) (p?<?0.05) was observed.This is an initial observation that in mouse red light LLLT more often than not causes opposite gene expression changes or reduces those caused by moderate UVA-UVB irradiation.

| S-EPMC4605358 | biostudies-other

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

Project description:We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

| S-EPMC4160947 | biostudies-literature

Comparison of the acute ultraviolet photoresponse in congenic albino hairless C57BL/6J mice relative to outbred SKH1 hairless mice.

Project description:Hairless albino Crl:SKH1-Hr(hr) mice are commonly utilized for studies in which hair or pigmentation would introduce an impediment to observational studies. Being an outbred strain, the SKH1 model suffers from key limitations that are not seen with congenic mouse strains. Inbred and congenic C57BL/6J mice are commonly utilized for modified genetic mouse models. We compare the acute UV-induced photoresponse between outbred SKH1 mice and an immune competent, hairless, albino C57BL/6J congenic mouse line [B6.Cg-Tyr(c-2J) Hr(hr) /J]. Histologically, B6.Cg-Tyr(c-2J) Hr(hr) /J skin is indistinguishable from that of SKH1 mice. The skin of both SKH1 and B6.Cg-Tyr(c-2J) Hr(hr) /J mice exhibited a reduction in hypodermal adipose tissue, the presence of utricles and dermal cystic structures, the presence of dermal granulomas and epidermal thickening. In response to a single 1500 J/m(2) ultraviolet B dose, the oedema and apoptotic responses were equivalent in both mouse strains. However, B6.Cg-Tyr(c-2J) Hr(hr) /J mice exhibited a more robust delayed sunburn reaction, with an increase in epidermal erosion, scab formation and myeloperoxidase activity relative to SKH1 mice. Compared with SKH1 mice, B6.Cg-Tyr(c-2J) Hr(hr) /J also exhibited an aberrant proliferative response to this single UV exposure. Epidermal Ki67 immunopositivity was significantly suppressed in B6.Cg-Tyr(c-2J) Hr(hr) /J mice at 24 h post-UV. A smaller non-significant reduction in Ki67 labelling was observed in SKH1 mice. Finally, at 72 h post-UV, SKH1 mice, but not B6.Cg-Tyr(c-2J) Hr(hr) /J mice, exhibited a significant increase in Ki67 immunolabelling relative to non-irradiated controls. Thus, B6.Cg-Tyr(c-2J) Hr(hr) /J mice are suitable for photobiology experiments.

| S-EPMC5002239 | biostudies-literature

Cutaneous transcriptome analysis in NIH hairless mice.

Project description:Mice with spontaneous coat mutations are ideal animal models for studying skin development and tumorigenesis. In this study, skin hair growth cycle abnormalities were examined in NIH hairless mice 42 days after birth (P42) by using hematoxylin-eosin (H&E) staining. To examine the gene expression patterns in the skin of mutant mice, the dorsal skin of P42 female NIH mice and NIH hairless mice was sequenced by RNA-Seq, and 5,068 differentially expressed genes (DEGs) were identified (false discovery rate [FDR] ? 2, P < 0.05). A pathway analysis showed that basal cell carcinoma, the cell cycle and the Hippo, Hedgehog and Wnt signaling pathways were up-regulated in NIH hairless mice. Previous studies have shown that these pathways are closely associated with cell proliferation, cell cycle, organ size and cancer development. In contrast, signal transduction, bacterial and parasitic infection, and receptor-mediated pathways, including calcium signaling, were down-regulated in NIH hairless mice. A gene interaction network analysis was performed to identify genes related to hair follicle development. To verify the reliability of the RNA-Seq results, we used q-PCR to analyze 12 key genes identified from the gene interaction network analysis, including eight down-regulated and four up-regulated genes, and the results confirmed the reliability of the RNA-Seq results. Finally, we constructed the differential gene expression profiles of mutant mice by RNA-Seq. NIH hairless mice exhibited abnormalities in hair development and immune-related pathways. Pik3r1 and Pik3r3 were identified as key genes, laying the foundation for additional in-depth studies of hairless mice.

| S-EPMC5546695 | biostudies-literature

Patterns of hairless (hr) gene expression in mouse hair follicle morphogenesis and cycling.

Project description:The hr (hairless) gene encodes a putative transcription factor with restricted expression in the skin and brain. Mutations in the hr locus cause papular atrichia in humans and complete hair loss in mice and other mammals. To further elucidate the role of hr in skin biology, and to identify potential target cells for hr regulation, we studied hr mRNA localization during hair follicle (HF) morphogenesis and cycling in normal C57BL/6J mice. In situ hybridization revealed that hr expression was present in the suprabasal cell layers of the epidermis, whereas the basal and highly differentiated keratinocytes of the granular layer were hr-negative. During the early stages of HF morphogenesis, hr mRNA was detected in the developing hair peg. Later, it became concentrated in the HF infundibulum, in the HF matrix, and in the inner root sheath (IRS), whereas the dermal papilla (DP) and outer root sheath were consistently hr mRNA-negative. During catagen, hr gene expression gradually declined in the regressing IRS, shortly but dramatically increased in the zone of developing club hair, and became up-regulated in the epithelial cells adjacent to the DP. The co-localization of hr mRNA with the site of the morphological defects in mutant skin implicates hr as a key factor in regulating basic cellular processes during catagen, including club hair formation, maintenance of DP-epithelial integrity, IRS disintegration, and keratinocyte apoptosis in the HF matrix.

| S-EPMC1850155 | biostudies-literature

Simple generation of hairless mice for in vivo imaging.

Project description:The in vivo imaging of mice makes it possible to analyze disease progress non-invasively through reporter gene expression. As the removal of hair improves the accuracy of in vivo imaging, gene-modified mice with a reporter gene are often crossed with Hos:HR-1 mutant mice homozygous for the spontaneous Hrhr mutation that exhibit a hair loss phenotype. However, it is time consuming to produce mice carrying both the reporter gene and mutant Hrhr gene by mating. In addition, there is a risk that genetic background of the gene-modified mice would be altered by mating. To resolve these issues, we established a simple method to generate hairless mice maintaining the original genetic background by CRISPR technology. First, we constructed the pX330 vector, which targets exon 3 of Hr. This DNA vector (5 ng/µl) was microinjected into the pronuclei of C57BL/6J mice. Induced Hr gene mutations were found in many founders (76.1%) and these mutations were heritable. Next, we performed in vivo imaging using these gene-modified hairless mice. As expected, luminescent objects in their body were detected by in vivo imaging. This study clearly showed that hairless mice could be simply generated by the CRISPR/Cas9 system, and this method may be useful for in vivo imaging studies with various gene-modified mice.

| S-EPMC5682356 | biostudies-literature

Gene expression profiles in dorsal skin of hairless mice orally administrated collagen hydrolysate

Project description:This SuperSeries is composed of the SubSeries listed below.

2015-06-12 | GSE62650 | GEO

Gene expression profiles in dorsal skin of hairless mice orally administrated collagen hydrolysate

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2015-06-12 | E-GEOD-62650 | biostudies-arrayexpress

Molecular basis for hair loss in mice carrying a novel nonsense mutation (Hrrh-R ) in the hairless gene (Hr).

Project description:Animal models carrying mutations in the hairless (Hr) gene provide a rich resource for study of hair follicle biology. A spontaneous mouse mutant with a phenotype strikingly similar to rhino mutants of Hr arose spontaneously in the mouse facility at Oak Ridge National Laboratory. Sequence analysis of Hr in these mutants uncovered a nonsense mutation in exon 12, designated as Hr(rh-R) (rhino, Oak Ridge). The mutation led to significant reduction in Hr mRNA levels, predicted to be due to nonsense-mediated decay. Histological analysis indicated dilated hair follicle infundibula at 14 days of age that rapidly became filled with cornified material. Microarray analyses revealed that expression levels of many genes involved in keratinocyte differentiation, epidermal regeneration, and wound healing were significantly upregulated before morphological detection of the phenotype, suggesting their role in onset of the Hr(rh-R) phenotype. Identification of this new Hr allele and the underlying molecular alterations allows further understanding of the role of Hr in hair follicle biology.

| S-EPMC2865226 | biostudies-literature

Hairless promotes PPAR? expression and is required for white adipogenesis.

Project description:Adipose tissue is the largest compartment in the mammalian body for storing energy as fat, providing an important reservoir of fuel for maintaining whole body energy homeostasis. Herein, we identify the transcriptional cofactor hairless (HR) to be required for white adipogenesis. Moreover, forced expression of HR in non-adipogenic precursor cells induces adipogenic gene expression and enhances adipocyte formation under permissive conditions. HR exerts its proadipogenic effects by regulating the expression of PPAR?, one of the central adipogenic transcription factors. In conclusion, our data provide a new mechanism required for white adipogenesis.

| S-EPMC3492706 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data