Characterization of genetically engineered mouse models carrying Col2a1-cre-induced deletions of Lrp5 and/or Lrp6.
Ontology highlight
ABSTRACT:
SUBMITTER: Schumacher CA
PROVIDER: S-EPMC4772748 | biostudies-other | 2016
REPOSITORIES: biostudies-other
Similar Datasets
Project description:Genetically engineered mouse models that employ site-specific recombinase technology are important tools for cancer research but can be costly and time-consuming. The CRISPR-Cas9 system has been adapted to generate autochthonous tumours in mice, but how these tumours compare to tumours generated by conventional recombinase technology remains to be fully explored. Here we use CRISPR-Cas9 to generate multiple subtypes of primary sarcomas efficiently in wild type and genetically engineered mice. These data demonstrate that CRISPR-Cas9 can be used to generate multiple subtypes of soft tissue sarcomas in mice. Primary sarcomas generated with CRISPR-Cas9 and Cre recombinase technology had similar histology, growth kinetics, copy number variation and mutational load as assessed by whole exome sequencing. These results show that sarcomas generated with CRISPR-Cas9 technology are similar to sarcomas generated with conventional modelling techniques and suggest that CRISPR-Cas9 can be used to more rapidly generate genotypically and phenotypically similar cancers.
| S-EPMC5508130 | biostudies-literature
Project description:Despite major improvement in treatment of early stage localised prostate cancer, the distinction between indolent tumors and those that will become aggressive, as well as the lack of efficient therapies of advanced prostate cancer, remain major health problems. Genetically engineered mice (GEM) have been extensively used to investigate the molecular and cellular mechanisms underlying prostate tumor initiation and progression, and to evaluate new therapies. Moreover, the recent development of conditional somatic mutagenesis in the mouse prostate offers the possibility to generate new models that more faithfully reproduce the human disease, and thus should contribute to improve diagnosis and treatments. The strengths and weaknesses of various models will be discussed, as well as future opportunities.
| S-EPMC5528413 | biostudies-other
Project description:Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal types of human cancer for which there are no effective therapies. Deep sequencing of PDAC tumors has revealed the presence of a high number of mutations (>50) that affect at least a dozen key signaling pathways. This scenario highlights the urgent need to develop experimental models that faithfully reproduce the natural history of these human tumors in order to understand their biology and to design therapeutic approaches that might effectively interfere with their multiple mutated pathways. Over the last decade, several models, primarily based on the genetic activation of resident KRas oncogenes knocked-in within the endogenous KRas locus have been generated. These models faithfully reproduce the histological lesions that characterize human pancreatic tumors. Decoration of these models with additional mutations, primarily involving tumor suppressor loci known to be also mutated in human PDAC tumors, results in accelerated tumor progression and in the induction of invasive and metastatic malignancies. Mouse PDACs also display a desmoplastic stroma and inflammatory responses that closely resemble those observed in human patients. Interestingly, adult mice appear to be resistant to PDAC development unless the animals undergo pancreatic damage, mainly in the form of acute, chronic or even temporary pancreatitis. In this review, we describe the most representative models available to date and how their detailed characterization is allowing us to understand their cellular origin as well as the events involved in tumor progression. Moreover, their molecular dissection is starting to unveil novel therapeutic strategies that could be translated to the clinic in the very near future.
| S-EPMC5528418 | biostudies-literature
Project description:Genetically engineered mouse models (GEMMs) are valuable research tools that have transformed our understanding of cancer. The first GEMMs generated in the 1980s and 1990s were knock-in and knock-out models of single oncogenes or tumor suppressors. The advances that made these models possible catalyzed both technological and conceptual shifts in the way cancer research was conducted. As a result, dozens of mouse models of cancer exist today, covering nearly every tissue type. The advantages inherent to GEMMs compared to in vitro and in vivo transplant models are compounded in preclinical radiobiology research for several reasons. First, they accurately and robustly recapitulate primary cancers anatomically, histopathologically, and genetically. Reliable models are a prerequisite for predictive preclinical studies. Second, they preserve the tumor microenvironment, including the immune, vascular, and stromal compartments, which enables the study of radiobiology at a systems biology level. Third, they provide exquisite control over the genetics and kinetics of tumor initiation, which enables the study of specific gene mutations on radiation response and functional genomics in vivo. Taken together, these facets allow researchers to utilize GEMMs for rigorous and reproducible preclinical research. In the three decades since the generation of the first GEMMs of cancer, advancements in modeling approaches have rapidly progressed and expanded the mouse modeling toolbox with techniques such as in vivo short hairpin RNA (shRNA) knockdown, inducible gene expression, site-specific recombinases, and dual recombinase systems. Our lab and many others have utilized these tools to study cancer and radiobiology. Recent advances in genome engineering with CRISPR/Cas9 technology have made GEMMs even more accessible to researchers. Here, we review current and future approaches to mouse modeling with a focus on applications in preclinical radiobiology research.
| S-EPMC6363345 | biostudies-literature
Project description:Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.
2024-10-22 | GSE206598 | GEO
Project description:Mucins are heavily O-glycosylated proteins primarily produced by glandular and ductal epithelial cells, either in membrane-tethered or secretory forms, for providing lubrication and protection from various exogenous and endogenous insults. However, recent studies have linked their aberrant overexpression with infection, inflammation, and cancer that underscores their importance in tissue homeostasis. In this review, we present current status of the existing mouse models that have been developed to gain insights into the functional role(s) of mucins under physiological and pathological conditions. Knockout mouse models for membrane-associated (Muc1 and Muc16) and secretory mucins (Muc2) have helped us to elucidate the role of mucins in providing effective and protective barrier functions against pathological threats, participation in disease progression, and improved our understanding of mucin interaction with biotic and abiotic environmental components. Emphasis is also given to available transgenic mouse models (MUC1 and MUC7), which has been exploited to understand the context-dependent regulation and therapeutic potential of human mucins during inflammation and cancer.
| S-EPMC4520780 | biostudies-literature
Project description:Breast cancer is the most common type of cancer in women. A substantial fraction of breast cancers have acquired mutations that lead to activation of the phosphoinositide 3-kinase (PI3K) signaling pathway, which plays a central role in cellular processes that are essential in cancer, such as cell survival, growth, division and motility. Oncogenic mutations in the PI3K pathway generally involve either activating mutation of the gene encoding PI3K (PIK3CA) or AKT (AKT1), or loss or reduced expression of PTEN. Several kinases involved in PI3K signaling are being explored as a therapeutic targets for pharmacological inhibition. Despite the availability of a range of inhibitors, acquired resistance may limit the efficacy of single-agent therapy. In this review we discuss the role of PI3K pathway mutations in human breast cancer and relevant genetically engineered mouse models (GEMMs), with special attention to the role of PI3K signaling in oncogenesis, in therapeutic response, and in resistance to therapy. Several sophisticated GEMMs have revealed the cause-and-effect relationships between PI3K pathway mutations and mammary oncogenesis. These GEMMs enable us to study the biology of tumors induced by activated PI3K signaling, as well as preclinical response and resistance to PI3K pathway inhibitors.
| S-EPMC5528412 | biostudies-other
Project description:3 Cell lines from Apc, p53 (AP) GEMMs were compared to 12 cell lines from Apc, Kras, p53 (AKP) GEMMs. Mouse 430 2.0 arrays were used to determine genomic expression differences between the two genotypes (AP and AKP). RNA was extracted from 3 AP and 10 AKP cell lines using the Qiagen RNEasy kit, and hybridized to individual Affymetrix mouse 430 2.0 chips as per manufacturer's instructions
2013-07-02 | E-GEOD-39557 | biostudies-arrayexpress
Project description:3 Cell lines from Apc, p53 (AP) GEMMs were compared to 12 cell lines from Apc, Kras, p53 (AKP) GEMMs. Mouse 430 2.0 arrays were used to determine genomic expression differences between the two genotypes (AP and AKP).
2013-07-02 | GSE39557 | GEO
Project description:The most common brain tumours, gliomas, have significant morbidity. Detailed biological and genetic understanding of these tumours is needed in order to devise effective, rational therapies. In an era generating unprecedented quantities of genomic sequencing data from human cancers, complementary methods of deciphering the underlying functional cancer genes and mechanisms are becoming even more important. Genetically engineered mouse models of gliomas have provided a platform for investigating the molecular underpinning of this complex disease, and new tools for such models are emerging that are enabling us to answer the most important questions in the field. Here, I discuss improvements to genome engineering technologies that have led to more faithful mouse models resembling human gliomas, including new cre/LoxP transgenic lines that allow more accurate cell targeting of genetic recombination, Sleeping Beauty and piggyBac transposons for the integration of transgenes and genetic screens, and CRISPR-cas9 for generating genetic knockout and functional screens. Applications of these technologies are providing novel insights into the functional genetic drivers of gliomagenesis, how these genes cooperate with one another, and the potential cells-of-origin of gliomas, knowledge of which is critical to the development of targeted treatments for patients in the clinic.
| S-EPMC6770673 | biostudies-literature