Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Ena-DATASET-ICR-GSR-03-10-2014-09:33:38:920-870 - samples

ABSTRACT: Exome sequencing of 1000 samples from the UK 1958 Birth Cohort. DNA library preps prepared with Illumina TruSeq sample preparation kit. The captured DNA libraries were PCR amplified using the supplied paired-end PCR primers. Sequencing was performed with an Illumina HiSeq2000 (SBS Kit v3, one pool per lane) generating 2x101-bp reads.

PROVIDER: EGAD00001001021 | EGA |

REPOSITORIES: EGA

ACCESS DATA

Json Xml

Publications

Mutations in the PP2A regulatory subunit B family genes PPP2R5B, PPP2R5C and PPP2R5D cause human overgrowth.

Loveday Chey C Tatton-Brown Katrina K Clarke Matthew M Westwood Isaac I Renwick Anthony A Ramsay Emma E Nemeth Andrea A Campbell Jennifer J Joss Shelagh S Gardner McKinlay M Zachariou Anna A Elliott Anna A Ruark Elise E van Montfort Rob R Rahman Nazneen N

Human molecular genetics 20150513 17

Overgrowth syndromes comprise a group of heterogeneous disorders characterised by excessive growth parameters, often in association with intellectual disability. To identify new causes of human overgrowth, we have been undertaking trio-based exome sequencing studies in overgrowth patients and their unaffected parents. Prioritisation of functionally relevant genes with multiple unique de novo mutations revealed four mutations in protein phosphatase 2A (PP2A) regulatory subunit B family genes prot ...[more]

PMID: 25972378

Similar Datasets

ena-DATASET-ICR-GSR-06-08-2015-17:20:28:712-26 - samples

Project description:Exome sequencing of 142 samples with corresponding Sanger sequencing results for 416 variants and 288 negative sites. DNA library preps prepared with Illumina TruSeq sample preparation kit. The captured DNA libraries were PCR amplified using the supplied paired-end PCR primers. Sequencing was performed with an Illumina HiSeq2000 (SBS Kit v3, one pool per lane) generating 2x101-bp reads.

| EGAD00001001462 | EGA

Exome sequencing of 1000 population control samples from the UK 1958 birth cohort

Project description:Exome sequencing from 1,000 UK population samples (the ICR1000 Exome series), using samples from the 1958 Birth Cohort Collection, a population-based collection of all individuals born in the UK in one week in 1958 (http://www.cls.ioe.ac.uk). DNA libraries were prepared from genomic DNA using the Illumina TruSeq sample preparation kit. DNA was fragmented using Covaris technology and the libraries were prepared without gel size selection. Target enrichment was performed in pools of six libraries using the Illumina TruSeq Exome Enrichment kit. The captured DNA libraries were PCR amplified using the supplied paired-end PCR primers. Sequencing was performed with an Illumina HiSeq2000 (v3 flow cell, one pool per lane) generating 2x100-bp reads.

| EGAS00001000971 | EGA

A collection of 142 samples used to evaluate the sensitivity and specificity of small-scale variation detection in exome-capture data with a particular focus on indel detection.

Project description:The dataset includes exome sequencing data and 704 Sanger sequencing validations for the 142 samples. The 704 Sanger sequencing validations are comprised of 416 variants and 288 sites known to be negative, including 293 indels and 247 negative indel sites. DNA libraries were prepared from genomic DNA using the Illumina TruSeq sample preparation kit. DNA was fragmented using Covaris technology and the libraries were prepared without gel size selection. Target enrichment was performed in pools of six libraries using the Illumina TruSeq Exome Enrichment kit. The captured DNA libraries were PCR amplified using the supplied paired-end PCR primers. Sequencing was performed with an Illumina HiSeq2000 (v3 flow cell, one pool per lane) generating 2x101-bp reads. Technology – Illumina HiSeq 2000

| EGAS00001001332 | EGA

Total RNA sequencing of IFN-stimulated and HIV-1-infected macrophages

Project description:Monocyte-derived macrophages were stimulated with 25 ng/ml of the indicated IFNs or infected with HIV-1-BaL-HSA. Total RNA was isolated 18 h following stimulation/infection using RNeasy minikit (Qiagen). Intact poly(A) RNA was purified from total RNA samples (100 to 500 ng) with oligo(dT) magnetic beads, and stranded mRNA sequencing libraries were prepared as described using the Illumina TruSeq Stranded mRNA Library Preparation kit (catalog no. RS-122-2101 and RS-122-2102). Purified libraries were qualified on an Agilent Technologies 2200 TapeStation using a D1000 ScreenTape assay (catalog no. 5067-5582 and 5067-5583). The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant kit (catalog no. KK4824). Individual libraries were normalized to 10 nM, and equal volumes were pooled in preparation for Illumina sequence analysis. Sequencing libraries (25 pM) were chemically denatured and applied to an Illumina HiSeq v4 single-read flow cell using an Illumina cBot system. Hybridized molecules were clonally amplified and annealed to sequencing primers with reagents from an Illumina HiSeq SR cluster kit v4-cBot (catalog no. GD-401-4001). Following transfer of the flow cell to an Illumina HiSeq 2500 instrument (HCSv2.2.38 and RTA v1.18.61), a 50-cycle single-read sequence run was performed using HiSeq SBS kit v4 sequencing reagents (catalog no. FC-401-4002).

2020-10-02 | GSE158434 | GEO

RNA-seq of nulliparus Robo1+/+ and Robo1-/- luminal progenitors

Project description:The goal of the study was to compare gene expression of Robo1+/+ and Robo1-/- luminal progenitors. Total RNAs were then extracted from FACS purified luminal progenitor cells, harvested from Robo1+/+ or Robo1-/- mice (n=3 per genotype, two animals per n) using TRIreagent LS (Sigma, T3934). Poly(A)+ RNA sequencing libraries were made from each sample using the TruSeq RNA library preparation kit v.1 (Illumina). Illumina RNA PolyA library preparation guide. A total of 6 libraries were created by PCR amplification with Illumina barcoding primers using kit recommended conditions and quantified using a Bioanalyzer DNA 1000 kit (Agilent).

2021-10-12 | GSE164707 | GEO

Integrated Analysis of Population Genomics, Transcriptomics and Virulence Provides Novel Insights into Streptococcus pyogenes Pathogenesis [50 strains]

Project description:Purpose: We used GAS as a model bacterial pathogen to investigate the complex relationship between genome, transcriptome, and virulence in a large population of type emm28 strains recovered from humans over 26 years in geographically diverse locations. Methods: We chose a subset of isolates from the sequenced population of 2,101 emm28 strains that would approximately span the genetic variation present in the entire population. Fifty emm28 strains were grown in triplicate, harvested at two time points, mid-exponential (ME) and early-stationary (ES) phases of growth, and assayed in triplicate by RNA-seq. rRNA was depleted using the Ribo-Zero rRNA removal kit for Gram-positive bacteria (Illumina) and libraries were made using the ScriptSeq complete kit for bacteria (Illumina). The cDNA libraries were prepared with indexed reverse primers from the ScriptSeq Index PCR primers kit (Illumina), and purified with AMPureXP beads (Beckman Coulter).

2018-12-31 | GSE113056 | GEO

ena-DATASET-Hospital Clinic Barcelona-13-08-2015-12:02:30:199-229 - samples

Project description:Whole Genome sequencing. 2 ÃŽÂ¼g of genomic DNA from each sample was used for the construction of two short-insert paired-end sequencing libraries. Both types of libraries were sequenced in paired-end mode on Illumina GAIIx (2 ÃƒÂ— 151 bp) using Sequencing kit v4 or Illumina HiSeq2000 (2x101 bp) using TruSeq SBS Kit v3.

| EGAD00001001466 | EGA

ATACseq in T. brucei wild-type and histone variant deletion cell lines.

Project description:3x107 cells were harvested and washed in 30 ml cold 1x TDB. The pellet was resuspended in 300 µl permeabilization buffer with protease inhibitors, 3 µl of 4 mM digitonin was added and incubated for 5 minutes at RT. The cells were pelleted, resuspended in 600 µl isotonic buffer with protease inhibitors and split in two samples, containing 1x107 and 2x107 cells, respectively. The transposition reaction was performed by adding 50 µl of transposition mix to the pellet (25 µl TD (2x reaction buffer from Nextera kit), 25 µl TDE1 (Tn5 transposase from Nextera kit), 22.5 µl nuclease-free water) and incubation for 30 minutes at 37 °C. For the gDNA control, 200 ng of gDNA was treated in the same manner. The DNA samples were purified using Qiagen MinElute PCR Purification Kit and eluted in 10 µl EB (10 mM Tris-HCl, pH 8). The transposed DNA fragments were amplified using the NEBNext® High-Fidelity 2X PCR Master Mix (M0541) supplied with 2.5 µl of 25 µM barcoded primers and amplification for 13 cycles. The libraries were purified using AMPure XP beads (Beckman Coulter) following the manufacturer’s instructions. The library fragment sizes between 150 and 1000 bp were purified from a 6% polyacrylamide gel. Paired-end 76 bp sequencing was carried out using the Illumina NextSeq system with a mid-output NextSeq 500/550 kit according to the manufacturer’s instructions.

2018-08-24 | GSE118902 | GEO

Accessory subunits are integral for assembly and function of human mitochondrial complex I

Project description:For analysis of mRNA expression levels, total RNA was harvested from each cell-line in replicate with Trizol™ (Thermo scientific). Total RNA was purified using Direct-zol™ columns according to the manufacturers specifications (Zymo Research). For cDNA synthesis 1 μg of total RNA was process as the T12VN-PAT assay (Jänicke et al., RNA 2012), except that this was adapted for multiplexing on the Illumina MiSeq instrument. We refer to this assay as mPAT for multiplexed PAT. The approach is based on a nested-PCR that sequentially incorporates the Illumina platform’s flow-cell specific terminal extensions onto 3’ RACE PCR amplicons. First, cDNA was generated using the anchor primer mPAT Reverse, next this primer and a pool of 50 gene-specific primers were used in 5 cycles of amplification. Each gene-specific primer had a universal 5’ extension (see supplementary file primers) for sequential addition of the 5’ (P5) Illumina elements. These amplicons were then purified using NucleoSpin columns (Macherey-Nagel), and entered into second round amplification using the universal Illumina Rd1 sequencing Primer and TruSeq indexed reverse primers from Illumina. Second round amplification was for 14 cycles. Note, that each experimental condition was amplified separately in the first round with identical primers. In the second round, a different indexing primer was used for each experimental condition. All PCR reactions were pooled and run using the MiSeq Reagent Kit v2 with 300 cycles (i.e. 300 bases of sequencing) according to the manufacturers specifications. Data were analysed using established bioinformatics pipelines (Harrison et al., RNA 2015)

2016-09-08 | GSE84913 | GEO

Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver

Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.

2022-01-26 | GSE125786 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data