Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A cell atlas of the adult Drosophila midgut

ABSTRACT: Drosophila guts were dissociated to single cells as previously described (Dutta et al., 2015) with a few modifications. Guts were dissected from 7-day old adult esg-sfGFP/+, pros- Gal4>RFP/+ females. After pulling out the gut, the crop and midgut/hindgut junction (where the Malpighian tubules branch out of the gut) and Malpighian tubules were removed. Five flies at a time were dissected and immediately transferred into cold PBS containing 1% BSA to avoid exposing the midgut tissue to room temperature for a long period of time. Once 40 guts were dissected, they were transferred to a dissection plate and chopped into small pieces using a razor blade. These small fragments were immediately transferred to an eppendorf tube containing 400 ul of 1 mg/ml elastase/PBS solution (Sigma E0258) and incubated on a shaker at 27 ̊C for 30 min. 1% of BSA in PBS (final concentration) was used to stop the digestion reaction and prevent cells from aggregating. The cell suspension was passed through 100 um and then a 40 um cell strainer and loaded on the top of Optiprep with density gradient 1.12 g/ml. Viable cells were isolated from the top layer of the sample after centrifugation at 800xg for 20 min. Cell viability and number were assessed by 0.4% trypan blue and hemocytometer.

ORGANISM(S): Drosophila melanogaster

PROVIDER: GSE120537 | GEO | 2019/12/19

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Organ-specific gene expression in single differentiating Drosophila embryos

Project description:Age-matched stage 13 embryos were dissected and cDNA of 8 organs from each embryo were sequenced. The organs were foregut, anterior midgut, posterior midgut, hindgut, Malpighian tubules, left salivary gland, right salivary gland, ventral nerve cord. Gene expression, transcription start and stop sites, and strands of termini were analysed. SMART amplification adapters were used for finding transcript termini and for phasing.

2017-02-01 | GSE77429 | GEO

Anopheles gambiae body parts

Project description:The transcriptional profile of four tissues for the multi insecticide Anopheles gambiae (Tiassale) and lab susceptible Anopheles gambiae strain N'Gousso. The malpighian tubules, abodmen integument (containing the fat body epidermal, neuronal, muscle and oenocyte cells), midgut and remaining structures were dissected and compared two ways: (i) each body part against the corresponding whole organism (ii) resistant against corresponding susceptible body parts.

2014-08-29 | E-MTAB-2808 | biostudies-arrayexpress

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Expression data from the mosquito Anopheles gambiae midgut 3h after a protein meal with or without E. coli.

Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria. Anopheles gambiae G3 mosquitoes 5-6 day-old were fed BSA (20% in PBS with fresh 10 mM sodium bicarbonate) with or without heat killed E. coli (equivalent of 2.5 ml of 0.8 OD) . Three pools of 10 mosquito midguts were dissected after 3h and processed for microarray analysis of gene expression.

2010-02-21 | E-GEOD-20204 | biostudies-arrayexpress

Whole genome expression analysis in the third-instar larval midgut of Drosophila melanogaster

Project description:Survival of insects on a substrate containing toxic substances such as plant secondary metabolites or insecticides is dependent on the metabolism or excretion of those xenobiotics. The primary sites of xenobiotic metabolism are the midgut, Malpighian tubules and fat body. In general, these organs are treated as single tissues by online databases, but several studies have shown that gene expression within subsections of the midgut is compartmentalized. In this article, RNA sequencing analysis was used to investigate whole-genome expression in subsections of the third-instar larval midgut. The results support functional diversification in subsections of the midgut. Analysis of the expression of gene families that are implicated in the metabolism of xenobiotics suggests that metabolism may not be uniform along the midgut. These data provide a starting point for investigating gene expression and xenobiotic metabolism in the larval midgut. Examination of expression in eight samples corresponding to compartments of gene expression in the midgut

2014-09-20 | E-GEOD-32329 | biostudies-arrayexpress

Whole genome expression analysis in the third-instar larval midgut of Drosophila melanogaster

2014-09-20 | GSE32329 | GEO

Aedes aegypti Malpighian tubules are immunologically activated following systemic Toll activation

Project description:Canine heartworm is a widespread and potentially fatal mosquito-borne disease caused by infections with the parasitic nematode, Dirofilaria immitis. We have previously shown that systemic activation of the Toll immune pathway via silencing of the negative regulator Cactus in Aedes aegypti blocks parasite development in the Malpighian tubules, the mosquito renal organ. However, it was not established whether the Malpighian tubules were directly responding to Toll activation or were alternatively responding to upregulated proteins or other changes to the hemolymph driven by other tissues. Distinguishing these possibilities is crucial for developing more precise strategies to block D. immitis while potentially avoiding the fitness cost to the mosquito associated with Cactus silencing. This study defines the transcriptional response of Ae. aegypti Malpighian tubules after systemic Toll activation via intra-thoracic injection of dsCactus and found, like the response of whole mosquitoes, a significant increase in expression of Toll pathway target genes. Additionally, we identified a significant overlap between the transcriptional response of the Malpighian tubules and proteins upregulated in the hemolymph. Our data show that Malpighian tubules are capable of RNAi-mediated gene silencing and directly respond to dsCactus treatment by upregulating canonical Toll pathway targets. Though not definitive, the strong correspondence between the Malpighian tubule transcriptional and the hemolymph proteomic responses provides evidence that the tubules may contribute to mosquito humoral immunity.

2024-08-27 | PXD036225 | Pride

Genes expressed in salivary glands and gut of Hessian fly larvae are likely involved in interactions with host plants

Project description:This SuperSeries is composed of the following subset Series: GSE18412: Expression in dissected larval tissues including gut, salivary glands, Malpighian tubules, and the remaining cascade GSE18413: Expression in larvae fed on resistant or susceptible plants, and in larvae that are at different developmental stages Refer to individual Series

2009-10-06 | E-GEOD-18414 | biostudies-arrayexpress

Comparison of Drosophila melanogaster Malpighian tubule v whole fly

Project description:This is an affymetrix array experiment comparing the transcriptome of the Malpighian tubule (or renal tubule) of 7-day adult Oregon R strain Drosophila melanogaster with matched whole fly samples. There are five tubule samples (each derived from approx 1000 tubules (!)), and 5 matched whole-fly samples. i.e. tubule 2 is dissected from the same vial as WholeFly2. As the tubule is probably the premier tissue for true physiology in Drosophila, the dataset can usefully be interrogated in conjunction with the detailed physiological understanding of the tissue: see http://fly.to/tubules

2004-08-24 | GSE1690 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data