Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

STAT3 secretion defect results in development abnormally

ABSTRACT: Total RNA from embryos (12 days) of STAT3mut/mut, STAT3mut/wt and STAT3wt/wt mice which come from the same womb were extracted using TRIzol reagent (Invitrogen) following the manufacturer’s protocols. RNA quantity, quality and integrity were analyzed with NanoDrop ND-1000 and standard denaturing agarose gel electrophoresis. Sample labeling and array hybridization were performed according to the Agilent One-Color Microarray-Based Gene Expression Analysis protocol of Agilent Technology. The Whole Mouse Genome Oligo Microarray (Agilent 4*44k) represents all known genes and transcripts in the mouse genome (Kyoto Encyclopedia of Genes and Genomes, KEGG). All the microarray experiments were performed by Kangchen Biotechnology Limited (Shanghai, China).

ORGANISM(S): Mus musculus

PROVIDER: GSE124348 | GEO | 2018/12/26

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Transcriptome analysis of embryos of STAT3-K177R/K180R mutant mice

Project description:Total RNA from embryos (12 days) of STAT3 homozygous and heterozygote mutant mice (K177/180R) and STAT3 wild type mice which come from the same womb were extracted using TRIzol reagent (Invitrogen) following the manufacturer’s protocols. RNA quantity, quality and integrity were analyzed with NanoDrop ND-1000 and standard denaturing agarose gel electrophoresis. Sample labeling and array hybridization were performed according to the Agilent One-Color Microarray-Based Gene Expression Analysis protocol of Agilent Technology. The Whole Mouse Genome Oligo Microarray (Agilent 4*44k) represents all known genes and transcripts in the mouse genome (Kyoto Encyclopedia of Genes and Genomes, KEGG). All the microarray experiments were performed by Kangchen Biotechnology Limited (Shanghai, China).

2024-07-20 | GSE271656 | GEO

Whole Human Genome Oligo Microarray

Project description:Human expression microarray analysis of the 11 samples that you submitted. Total RNA from each sample was quantified using the NanoDrop ND-1000 and the RNA integrity was assessed using standard denaturing agarose gel electrophoresis. For microarray analysis, Agilent Array platform was employed. The sample preparation and microarray hybridization were performed according to the manufacturer’s standard protocols. Briefly, total RNA from each sample was amplified and transcribed into fluorescent cRNA with using the manufacturer’s Agilent’s Quick Amp Labeling protocol (version 5.7, Agilent Technologies). The labeled cRNAs were hybridized onto the Whole Human Genome Oligo Microarray (4x44K, Agilent Technologies). After having washed the slides, the arrays were scanned by the Agilent Scanner G2505C. Agilent Feature Extraction software (version 11.0.1.1) was used to analyze acquired array images. Quantile normalization and subsequent data processing were performed using the GeneSpring GX v11.5 software package (Agilent Technologies). After quantile normalization of the raw data, genes that at least 7 out of 11 samples have flags in Detected (“All Targets Value”) were chosen for further data analysis.

2017-03-02 | GSE95563 | GEO

Expression profiling of Natural killer B cells

Project description:Investigation of global gene expression levels between B cells, Natural killer cells and Natural killer B cells Gene expression profiling using sorted B cells, Natural killer cells and Natural killer B cells from WT mouse spleen. Total RNA extracted from WT cells were quantified by the NanoDrop ND-1000 and RNA integrity was assessed by standard denaturing agarose gel electrophoresis. The sample preparation and microarray hybridization were performed based on the NimbleGenâs standard protocols.

2016-05-17 | E-GEOD-80063 | biostudies-arrayexpress

Effect of FTO (fat mass and obesity-associated) overexpression on gene expression profiling in beta cells

Project description:We have completed the mouse expression microarray analysis of the 2 samples. Total RNA from each sample was quantified using the NanoDrop ND-1000 and the RNA integrity was assessed using standard denaturing agarose gel electrophoresis. For microarray analysis, Agilent Array platform was employed. The sample preparation and microarray hybridization were performed based on the manufacturer’s standard protocols. Briefly, total RNA from each sample was amplified and transcribed into fluorescent cRNA with using the manufacturer’s Agilent’s Quick Amp Labeling protocol (version 5.7, Agilent Technologies). The labeled cRNAs were hybridized onto the Whole Mouse Genome Oligo Microarray (4x44K, Agilent Technologies). After having washed the slides, the arrays were scanned by the Agilent Scanner G2505C.Agilent Feature Extraction software (version 11.0.1.1) was used to analyze acquired array images. Quantile normalization and subsequent data processing were performed using the GeneSpring GX v11.5 software package (Agilent Technologies). After quantile normalization of the raw data, genes that at least 1 out of 2 samples have flags in Detected (“All Targets Value”) were chosen for further data analysis. Differentially expressed genes between two samples were identified through fold change filtering. Pathway analysis and GO Analysis were applied to determine the roles of these differentially expressed genes played in these biological pathways or GO terms. Finally, Hierarchical Clustering was performed to show the distinguishable gene expression profiling between samples.

2015-01-06 | GSE64668 | GEO

Protein binding to PDCD4 promoter X-box in Nutlin-3a treated U2OS cells

Project description:Human PDCD4 wild-type (wt) promoter fragments were amplified from U2OS genomic DNA and X-box deletion mutants (mut) were generated using the QuikChange site-directed mutagenesis kit (Agilent Technologies). DNA probes for affinity purification with the same sequences were obtained by PCR using a biotinylated primer for labeling the 3' end (Thermo Fisher Scientific). DNA affinity purification with nuclear extracts from Nutlin-3a treated U2OS cells.

2024-08-08 | PXD020932 | Pride

mRNA expression analysis of AR, HOXC6 and NKX2-2 overexpression

Project description:Investigation of mRNA expression level changes in RWPE1 cells with AR,HOXC6 and NKX2-2 overexpression. RNA quantity and quality were measured by NanoDrop ND-1000. RNA integrity was assessed by standard denaturing agarose gel electrophoresis.

2017-06-13 | GSE81232 | GEO

Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver

Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.

2022-01-26 | GSE125786 | GEO

Expression analysis of WASH knockout LT-HSC cells

Project description:Investigation of whole genome gene expression level changes in WASH knockout LT-HSCs, compared to the WASH WT strain. To find the reason that causes LT-HSC abnormal. Gene expression profiling using sorted LT-HSC samples from C57/BL6 strain. Total RNA extracted from WASH control (isolated RNA from WT, IRWT) and knockout mice (IRKO) were quantified by the NanoDrop ND-1000 and RNA integrity was assessed by standard denaturing agarose gel electrophoresis.Each chip measures the expression level of 44, 170 genes from Mus Musculus.

2014-05-17 | E-GEOD-57741 | biostudies-arrayexpress

Gene expression profiling of CEBPA double and single mutant and CEBPA wild type AML.

Project description:Mutations in CCAAT/enhancer binding protein alpha (CEBPA) are seen in 5-14% of acute myeloid leukemia (AML) and have been associated with a favorable clinical outcome. Most AMLs with CEBPA mutations simultaneously carry two mutations (CEBPAdouble-mut), usually biallelic, while single heterozygous mutations (CEBPAsingle-mut) are less frequently seen. Using denaturing high performance liquid chromatography and nucleotide sequencing we identified among a cohort of 598 newly diagnosed AMLs a subset of 41 CEBPA mutant cases, i.e. 28 CEBPAdouble-mut and 13 CEBPAsingle-mut cases. CEBPAdouble-mut associated with a unique gene expression profile as well as favorable overall and event-free survival, retained in multivariable analysis that included cytogenetic risk, FLT3-ITD and NPM1 mutation, white blood cell count and age. In contrast, CEBPAsingle-mut AMLs did not express a discriminating signature and could not be distinguished from wild type cases as regards clinical outcome. These results demonstrate significant underlying heterogeneity within CEBPA mutation positive AML with prognostic relevance. Keywords: Gene expression profiling by arrays

2009-01-21 | GSE14468 | GEO

Molecular insight into the Lin28R192G mutation in human ESCs

Project description:Total RNA-seq analyses for the differentially expressed genes (DEGs) among WT (c42), Lin28 R192G hetero mut hESC (c26_5), and Lin28 R192G homo mut hESC (c38) To gain further molecular insight into the observed Lin28R192G mutation in human ESCs, we performed total RNA-sequencing (RNA-seq) analysis of the WT, Lin28 R192G hetero mut hESC, and Lin28 R192G homo mut hESC. The genes that are differentially expressed (DEGs) in Lin28 R192G hetero mut and Lin28 R192G homo mut hES compared to WT hESC.

2019-08-20 | GSE135994 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data