Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Resistance mechanisms to SYK inhibition in AML

ABSTRACT: Resistance mechanisms to SYK inhibition in AML

PROVIDER: PRJNA532524 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR8887030.fastq.gz	Fastqsanger.gz
	SRR8887040.fastq.gz	Fastqsanger.gz
	SRR8887050.fastq.gz	Fastqsanger.gz
	SRR8887031.fastq.gz	Fastqsanger.gz
	SRR8887041.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 24

Similar Datasets

Resistance mechanisms to SYK inhibition in AML

Project description:Targeted therapy studies with small molecules against kinases, such as spleen tyrosine kinase (SYK), are underway in patients with acute myeloid leukemia (AML) and show promising initial results. Identifying the potential mechanism of resistance and finding new drug combinations to overcome them, however, is essential for the long-term success of these targeted agents. Here, we conducted a genome-scale ORF resistance screen and identified activation of the RAS/MAPK/ERK signaling pathway as one major mechanism of resistance to SYK inhibition. This finding was validated in AML cell lines with innate and acquired resistance to a SYK inhibitor and in AML samples from patients who developed resistance to SYK inhibition. In order to circumvent this resistance, we demonstrate the synergistic activity of a MEK Inhibitor in combination with a SYK inhibitor in RAS mutated cells, as well as in entospletinib-resistant AML cells.

2020-01-16 | GSE129698 | GEO

Project description:Resistance mechanisms to SYK inhibition in AML

| PRJNA532457 | ENA

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

2014-01-15 | GSE54065 | GEO

Project description:Resistance mechanisms to SYK inhibition in AML - 2nd generation

| PRJNA565774 | ENA

Effect of SYK inhibition on gene expression during ivosidenib induced differentiation of IDH1-mutated murine bone marrow cells (OCI-mIDH1/N)

Project description:To investigate the mechanisms by which SYK inhibition sensitizes OCI-mIDH1/N cells to ivosidenib, we performed RNA sequencing (RNA-seq) analysis of cells treated with DMSO (vehicle control), ivosidenib alone, fostamatinib alone, entospletinib alone, or the combination of ivosidenib with each of the two SYK inhibitors for 9 days.

2022-11-08 | GSE217442 | GEO

Rapid Idiosyncratic Mechanisms of Clinical Resistance to KRAS G12C Inhibition

Project description:Rapid Idiosyncratic Mechanisms of Clinical Resistance to KRAS G12C Inhibition

| PRJNA789386 | ENA

Mechanisms of resistance to oncogenic KRAS inhibition in pancreatic cancer

Project description:Mechanisms of resistance to oncogenic KRAS inhibition in pancreatic cancer

| PRJNA1121188 | ENA

Mechanisms of resistance to oncogenic KRAS inhibition in pancreatic cancer

Project description:Mechanisms of resistance to oncogenic KRAS inhibition in pancreatic cancer

| PRJNA1124557 | ENA

Rapid Idiosyncratic Mechanisms of Clinical Resistance to KRAS G12C Inhibition

Project description:Rapid Idiosyncratic Mechanisms of Clinical Resistance to KRAS G12C Inhibition