RNA-seq of total RNA in budding yeast wild-type and rrp6∆ strains, and in dbr1∆ or sen1-1 dbr1∆ strains expressing either a control or decoy RNA.
Ontology highlight
ABSTRACT:
ORGANISM(S): Saccharomyces cerevisiae W303
PROVIDER: GSE137632 | GEO | 2020/07/24
REPOSITORIES: GEO
Similar Datasets
Project description:We obtained Nab3, Nrd1, and RNA polymerase II occupancy profiles across the genome of S.cerevisiae in wild-type and rrp6∆ strains. This allowed us to determine the impact of defective nuclear exosome on NNS-dependent transcription termination.
2020-07-24 | GSE137881 | GEO
Project description:RNA-seq of total RNA in budding yeast wild-type and rrp6∆ strains, and in dbr1∆ or sen1-1 dbr1∆ strains expressing either a control or decoy RNA.
| PRJNA566113 | ENA
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:RNAPII is responsible for transcription of protein-coding genes and short, regulatory RNAs. In Saccharomyces cerevisiae, termination of RNAPII-transcribed RNAs ≤1000 bases requires the NNS complex (comprised of Nrd1, Nab3, and Sen1) processing by the exosome, and the nuclear specific catalytic subunit, Rrp6. It has been shown that Rrp6 interacts directly with Nrd1, but whether or not Rrp6 is required for NNS-dependent termination is unclear. Loss of Rrp6 function may result in extension (or inhibition of termination) of NNS-dependent transcripts, or Rrp6 may only function after the fact to carry out RNA 3’ end processing. Here, we performed in-depth differential expression analyses and compare RNA-sequencing data of transcript length and abundance in cells lacking RRP6 to previously published sequencing data measuring the length of RNAs in Nrd1-depleted cells. We find many transcripts that were defined as unterminated upon loss of Nrd1 activity are of similar length in rrp6Δ, and expression levels of downstream genes are significantly decreased. This suggests a similar transcription interference mechanism occurs in cells lacking either Nrd1 or Rrp6, supporting the hypothesis that Rrp6 activity is required for proper NNS termination in vivo. Four biological replicates each for deletion mutant (RRP6) and reference cells (WT)
2015-04-14 | E-GEOD-57155 | biostudies-arrayexpress
Project description:RNAPII is responsible for transcription of protein-coding genes and short, regulatory RNAs. In Saccharomyces cerevisiae, termination of RNAPII-transcribed RNAs ≤1000 bases requires the NNS complex (comprised of Nrd1, Nab3, and Sen1) processing by the exosome, and the nuclear specific catalytic subunit, Rrp6. It has been shown that Rrp6 interacts directly with Nrd1, but whether or not Rrp6 is required for NNS-dependent termination is unclear. Loss of Rrp6 function may result in extension (or inhibition of termination) of NNS-dependent transcripts, or Rrp6 may only function after the fact to carry out RNA 3’ end processing. Here, we performed in-depth differential expression analyses and compare RNA-sequencing data of transcript length and abundance in cells lacking RRP6 to previously published sequencing data measuring the length of RNAs in Nrd1-depleted cells. We find many transcripts that were defined as unterminated upon loss of Nrd1 activity are of similar length in rrp6Δ, and expression levels of downstream genes are significantly decreased. This suggests a similar transcription interference mechanism occurs in cells lacking either Nrd1 or Rrp6, supporting the hypothesis that Rrp6 activity is required for proper NNS termination in vivo.
2015-04-14 | GSE57155 | GEO
Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.
2019-02-14 | GSE126503 | GEO
Project description:MicroRNA-10b may target numerous genes in gliomagenesis. The target genes of miR-10b may differ according to the cellular context. We used microarray analyses to determine the phenotypic effects and gene targets of miR-10b by silencing miR-10b in invasive U87-2M1 glioma cells. Early passage U87-2M1 cells treated with the baculoviral control decoy vector or miR-10b decoy vector were selected for RNA extraction and hybridization on microarray
2012-12-31 | E-GEOD-35170 | biostudies-arrayexpress
Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.
2019-01-31 | PXD012564 | Pride
Project description:Transcription termination is key to gene regulation as it prevents transcription interference with neighboring genes. In Saccharomyces cerevisiae, termination at protein-coding genes is coupled to the cleavage of the nascent transcript, while most non-coding RNA transcription relies on a cleavage-independent termination pathway involving Nrd1, Nab3 and the helicase Sen1 (NNS pathway). In both pathways, the recruitment of termination factors involves phosphorylated forms of the RNA polymerase II C-terminal domain (CTD) but the contribution of individual CTD residues was never systematically investigated. Here, we investigated the impact of mutating phosphorylation sites in the CTD on termination. We observed widespread termination defects at protein-coding genes in mutants for Ser2 or Thr4 but rare defects in Tyr1 mutants for this class of genes. Instead, mutating Tyr1, or its phosphatase Glc7, led to widespread termination defects at non-coding genes known to terminate via the NNS pathway. These defects can be suppressed by slowing down transcription, suggesting that Tyr1 mediates termination via the regulation of elongation or pausing. Our work redefines the role of Tyr1 in termination at protein-coding genes in budding yeast and highlights its key role in termination by the NNS pathway.
2019-01-21 | GSE115027 | GEO