Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A Phase 1b Randomized Single-Center Trial of Topical Cerdulatinib (DMVT-502) in Patients with Mild-to-Moderate Atopic Dermatitis

ABSTRACT: This phase 1b, single-center, double-blind study evaluated safety, efficacy, and effect on molecular profiles of a topical Janus kinase/spleen tyrosine kinase (JAK/Syk) inhibitor, cerdulatinib gel 0.37%, in ten adults with mild-to-moderate atopic dermatitis (AD).

ORGANISM(S): Homo sapiens

PROVIDER: GSE141570 | GEO | 2020/11/12

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Pathologic Immune Pathways in Psoriasis are Rapidly Attenuated by Tofacitinib Treatment: A Randomized Phase 2 Study in Patients with Moderate to Severe Psoriasis

Project description:Here we elucidate the molecular mechanism of tofacitinib, an oral Janus kinase inhibitor, in psoriasis. Tofacitinib exhibits a multi-tiered action, with early direct effects on keratinocytes and histological and transcriptomic improvement prior to IL-17 reduction. Twelve patients with plaque psoriasis were randomized (3:1) to receive tofacitinib 10Â mg or placebo twice daily for 12 weeks. Biopsies were taken from lesional and nonâlesional skin at baseline, and from lesional skin on Day 1, Day 3, and Weeks 1, 2, 4 and 12. Biopsies were examined for psoriatic epidermal features (thickness; Ki67+ keratinocytes, keratin 16 [KRT16] mRNA expression; phosphoSTAT [pSTAT] + nuclei) and T-cell and dendritic cell (DC) subsets using immunohistochemistry. mRNA transcripts were quantified by microarray.

2016-06-30 | E-GEOD-69967 | biostudies-arrayexpress

A Phase 1b Randomized Single-Center Trial of Topical Cerdulatinib (DMVT-502) in Patients with Mild-to-Moderate Atopic Dermatitis

Project description:A Phase 1b Randomized Single-Center Trial of Topical Cerdulatinib (DMVT-502) in Patients with Mild-to-Moderate Atopic Dermatitis

| PRJNA593978 | ENA

Pathologic Immune Pathways in Psoriasis are Rapidly Attenuated by Tofacitinib Treatment: A Randomized Phase 2 Study in Patients with Moderate to Severe Psoriasis

Project description:Tofacitinib is an oral Janus kinase inhibitor being investigated for psoriasis. We sought to elucidate the molecular mechanisms underlying the clinical efficacy of tofacitinib in patients with psoriasis. Twelve patients with plaque psoriasis were randomized (3:1) to receive 10 mg of tofacitinib or placebo twice daily for 12 weeks. Biopsy specimens were taken from nonlesional (baseline) and lesional (baseline, days 1 and 3, and weeks 1, 2, 4, and 12) skin. Biopsy specimens were examined for psoriatic epidermal features (thickness, Ki67+ keratinocytes and keratin 16 [KRT16] mRNA expression, and phosphorylated signal transducer and activator of transcription [pSTAT]+ nuclei) and T-cell and dendritic cell (DC) subsets by using immunohistochemistry, and mRNA transcripts were quantified by using a microarray. In lesional skin keratinocyte pSTAT1 and pSTAT3 staining was increased at baseline but reduced after 1 day of tofacitinib (baseline, median of 1290 pSTAT1+ cells/?m2; day 1, median of 332 pSTAT1+ cells/?m2; and nonlesional, median of 155 pSTAT1+ cells/?m2). Epidermal thickness and KRT16 mRNA expression were significantly and progressively reduced after days 1 and 3 of tofacitinib administration, respectively (eg, KRT16 decreased 2.74-fold, day 3 vs baseline, P = .016). Decreases in DC and T-cell numbers were observed after weeks 1 and 2, respectively. At week 4, significant decreases in IL-23/TH17 pathways were observed that persisted through week 12. Improvements in clinical and histologic features were strongly associated with changes in expression of psoriasis-related genes and reduction in IL-17 gene expression. Tofacitinib has a multitiered response in patients with psoriasis: (1) rapid attenuation of keratinocyte Janus kinase/STAT signaling; (2) removal of keratinocyte-induced cytokine signaling, leading to reductions in pathologic DC and T-cell numbers to nonlesional levels; and (3) inhibition of the IL-23/TH17 pathway.

2016-06-30 | GSE69967 | GEO

A Phase 2 Randomized, Double-blind Pilot Study of IL-17-Targeting with 2 Secukinumab in Moderate-to-Severe Atopic Dermatitis

Project description:This randomized, double-blind, phase 2 study aimed to investigate the efficacy and safety of secukinumab as compared to placebo in 41 subjects with moderate-to-severe AD over a 16-week period, with evaluations of clinical outcomes and molecular and cellular profiles in skin.

2020-09-01 | GSE137430 | GEO

Topical pravibismane as adjunctive therapy for moderate or severe diabetic foot infections: A phase 1b randomized, multicenter, double-blind, placebo-controlled trial.

Project description:This Phase 1b study was designed to evaluate the safety and efficacy of pravibismane, a novel broad-spectrum topical anti-infective, in managing moderate or severe chronic diabetic foot ulcer (DFU) infections. This randomized, double-blind, placebo-controlled, multicenter study consisted of 39 individuals undergoing pravibismane treatment and 13 individuals in the placebo group. Assessment of safety parameters included clinical observations of tolerability and pharmacokinetics from whole blood samples. Pravibismane was well-tolerated and exhibited minimal systemic absorption, as confirmed by blood concentrations that were below the lower limit of quantitation (0.5 ng/mL) or in the low nanomolar range, which is orders of magnitude below the threshold of pharmacological relevance for pravibismane. Pravibismane treated subjects showed approximately 3-fold decrease in ulcer size compared to the placebo group (85% vs. 30%, p = 0.27). Furthermore, the incidence of ulcer-related lower limb amputations was approximately 6-fold lower (2.6%) in the pooled pravibismane group versus 15.4% in the placebo group (p = 0.15). There were no treatment emergent or serious adverse events related to study drug. The initial findings indicate that topical pravibismane was safe and potentially effective treatment for improving recovery from infected chronic ulcers by reducing ulcer size and facilitating wound healing in infected DFUs (ClinicalTrials.gov Identifier NCT02723539).

| S-EPMC10988878 | biostudies-literature

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

2014-01-15 | GSE54065 | GEO

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Oral JAK/SYK-inhibition (ASN002) suppresses inflammation and improves epidermal barrier markers in atopic dermatitis

Project description:We conducted a randomized, double-blind, placebo-controlled trial in adults with moderate-to-severe AD to test the efficacy of JAK/SYK-inhibitor ASN002. ASN002 significantly suppressed key AD inflammatory pathways, corresponding to clinical response, and may be an effective novel therapeutic agent for moderate-to-severe AD.

2019-07-18 | GSE133385 | GEO

A Phase 2 Randomized Trial of Apremilast in Patients With Atopic Dermatitis

Project description:A phase 2, double-blind, placebo-controlled trial evaluated apremilast efficacy, safety, and pharmacodynamics in adults with moderate to severe atopic dermatitis (AD).

2018-10-06 | GSE120899 | GEO

SYK activity modulates the EGFR-dependent transcriptome

Project description:Background: Among all gynecologic malignancies, epithelial ovarian cancer has the highest case-to-fatality ratio. Most patients are diagnosed at advanced stages and recurrence is common and accounts for disease-related mortality. Spleen tyrosine kinase (SYK) is an emerging cancer-associated kinase upregulated in recurrent tumors and is amenable for inhibition using small compounds that have been studied in clinical trials for autoimmune diseases. Our previous proteomic analysis identified several novel SYK substrates including EGFR and ERBB2. Here, we investigated the cross-talk between these pathways in ovarian carcinomas. Methods: Immunohistochemistry and immunoblotting were utilized to assess SYK and EGFR phosphorylation in ovarian serous carcinomas. Association with survival was determined by Kaplan-Meier analysis and the log-rank test. To study its role in EGFR signaling, SYK activity was modulated using a small molecule inhibitor, a syngeneic knockout, and an active kinase inducible system. We applied RNA-seq to investigate the SYK-regulated EGF-induced transcriptome. Results: Intense immunoreactivity of active pSYK(Y525/526) correlated with poor overall survival in two independent ovarian cancer cohorts. SYK directly phosphorylated EGFR and ERBB2, while knockout of SYK reduces their phosphorylation. Phosphorylation levels of SYK(Y525/526) positively correlated with EGFR(Y1187) and STAT3(Y705). Active SYK reduced sensitivity to the EGFR/ERBB2 inhibitor, lapatinib, and SYK non-phosphorylatable EGFR mutant was more sensitive to paclitaxel. SYK modulated the EGF-induced transcriptome, supporting its involvement in EGFR/ERBB2-regulated transcriptional activity. Conclusions: Our findings suggest an upstream role of SYK in regulating the EGFR/ERBB2 signaling, and provide a biological rationale for targeting SYK in ovarian cancer therapy.

2020-11-08 | GSE106716 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data