Dataset Information

Microarray profiling analysis of lncRNAs expression in renal cell carcinoma cells

ABSTRACT: Despite sunitinib contributes to prolong the progression-free survival of metastatic renal cell carcinoma significantly, the universal presence of resistance limits the initial response rate and restricts durable responses. The mechanisms involved in sunitinib resistance vary and need further investigation. We found lncRNA CCAT1 overexpressed in sunitinib resistant cells while declined in the parental cells. Moreover, lncRNA CCAT1 increased significantly in samples with resistance to sunitinib compared to those with responses to sunitinib. Impoverishment of CCAT1 suppressed cell growth and colony formation while triggered apoptosis. Inversely, the ectopic expression of c-Myc reversed the inhibition of cell growth and enhancement of apoptosis by sh-CCAT1. We also verified that anti-apoptosis protein Bcl-2 and Mcl-1 decreased along with the deregulation of CCAT1, whereas the expression of Bcl-2 and Mcl-1 restored in cells those were transfected sh-CCAT1 and c-Myc simultaneously. Apart from the in vitro experiments, we demonstrated that knockdown of CCAT1 boosted response to sunitinib by performing sunitinib-resistant ACHN mouse models. Briefly, lncRNA CCAT1 conferred renal cell carcinoma resistance to sunitinib in a c-Myc-dependent manner, providing novel target for improvement of sunitinib therapy.

ORGANISM(S): Homo sapiens

PROVIDER: GSE146305 | GEO | 2020/03/15

REPOSITORIES: GEO

ACCESS DATA

Shared Molecules

Only show the datasets with similarity scores above: 0.5

Threshold

0.5

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.