Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression data from NS398-treated and control HT29 colon adenocarcinoma cell line samples

ABSTRACT: The whole-genome oligonucleotide microarray analysis of NS398-treated HT29 colon adenocarcinoma cells samples can give an insight into global molecular background of selective COX2 inhibitor administration in order to find other target molecules and pathways influenced by NS398 selective COX2 inhibitor treatment in the epithelial cells.

ORGANISM(S): Homo sapiens

PROVIDER: GSE15799 | GEO | 2010/03/03

SECONDARY ACCESSION(S): PRJNA117015

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Expression data from NS398-treated and control HT29 colon adenocarcinoma cell line samples

Project description:The whole-genome oligonucleotide microarray analysis of NS398-treated HT29 colon adenocarcinoma cells samples can give an insight into global molecular background of selective COX2 inhibitor administration in order to find other target molecules and pathways influenced by NS398 selective COX2 inhibitor treatment in the epithelial cells. Total RNA was extracted from NS398-treated and control HT29 colon adenocarcinoma cells and hybridized on Affymetrix HGU133 Plus 2.0 microarrays

2010-03-16 | E-GEOD-15799 | biostudies-arrayexpress

Native SEC-MS of the human HT29 colon adenocarcinoma cell line treated with the HSP90 inhibitor tanespimycin (17-AAG)

Project description:The molecular chaperone heat shock protein 90 (HSP90) works in concert with its co-chaperones to stabilize its client proteins, which include several drivers of oncogenesis and malignant progression. Pharmacologic inhibitors of HSP90 are proposed to trigger widespread remodeling of cellular protein complexes, including dissociation of co-chaperones from HSP90, disruption of client protein signaling networks, and recruitment of the protein ubiquitination and degradation machinery. However, proteomic studies to date have focused on inhibitor-induced changes in total protein levels, often overlooking protein complex alterations. Here, we use size-exclusion chromatography in combination with mass spectrometry (SEC-MS) to characterize the changes in native protein complexes following treatment with the HSP90 inhibitor 17-AAG in the human HT29 colon adenocarcinoma cell line.

2022-12-20 | PXD033459 | Pride

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

Colon cancer HT29 cells: siHX transfected vs. control

Project description:HT29 cells were transsfected with siRNA (siHX), which is targeting the human endogeous retrovirus HERV-HX. Cells were harvested 72 h after transfection and knock-down of HERV-HX was evaluated by quantitative RT-PCR. Keywords: Genetic modification

2009-01-01 | GSE14257 | GEO

Transcriptome analysis of novel CPT-CEF-treated HT29 colon cancer cells to evaluate drug cytotoxicity

Project description:Purpose: To identify differentially expressed genes in HT29 colon cancer cells after treatment with a novel formulation of camptothecin with β-cyclodextrin-EDTA-Fe3O4 nanoparticle-conjugated nanocarriers (CPT-CEF) Methods:Treated HT29 cell lines with CPT-CEF, isolated total RNA from HT29 colon cancer cells, and prepared library for RNA sequencing. Carried out comparative transcriptomic studies between treated and untreated cells to find out which gene functions were dysregulated by CPT-CEF. Results: The study yielded 247 DEGs ((FDR<0.05, FC>2.0) that were affected by CPT-CEF treatment in the HT29 colon cancer cells. The results obtained from cell cycle analysis, mitochondrial depolarization assay and acridium orange/propidium iodide double staining showed potential of CPT-CEF in cancer cell inhibition. Conclusion: Our study successfully identified DEGs in the CPT-CEF treated HT29 colon cancer cells that pointed to inhibition of cancer progression. To further affirm, animal studies are needed.

2021-09-15 | GSE165875 | GEO

HT29 and GATA6

Project description:HT29 and GATA6

| PRJNA263819 | ENA

Diverse effect of WWOX overexpression in HT29 colon cancer cell line.

Project description:The WWOX gene is a tumor suppressor probably involved in regulation of cell cycle and apoptosis and downregulated in variety of cancer types.However, its role in colon cancerogenesis is unknown. The aim of this study was to characterize how WWOX may be involved in colon cancerogenesis or cancer progression, how it influences the basic cancer cell features and modifies cell expression profile.Our observations suggest that in HT29 colon cancer cell line increased expression of WWOX may result in transition of cancer cells into more normal- like colon epithelium phenotype, on the other hand in SW480 WWOX revealed the well-known tumour suppressor properties. However, as the colon cancer is very heterogeneous disease, obtained discrepancies may reflect the known differences between cell lines and cancerogenesis pathway, which they undergone. HT29 colon cancer cells were stably transfected with WWOX cDNA. HT29 cells transfected with an empty vector served as a control. Total mRNA was isolated to look for gene-expression differences induced by the WWOX overexpression.

2014-01-23 | E-GEOD-54298 | biostudies-arrayexpress

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

2020-08-13 | GSE65979 | GEO

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

Project description:Analysis of differentially expressed genes in colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours. Total RNA obtained from colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours.

2016-07-17 | E-GEOD-65979 | biostudies-arrayexpress

Expression data from shROR HT29 and AGS cell

Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion.

2015-06-05 | GSE67416 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data