Dataset Information

The Role of LINGO1 in Epithelial Wound Repair

ABSTRACT: Leucine-rich repeat and IgG-like domain containing NOGO-receptor interacting protein 1 (LINGO1) has an inhibitory role in neuronal growth and regeneration following injury; yet LINGO1 involvement in the injury response of other tissues has not been thoroughly explored. Previous studies have demonstrated that the reparative cytokines of the Trefoil factor family interact with members of the LINGO receptor family in maintenance of gastrointestinal barrier integrity, suggesting a role for LINGO receptors in epithelial repair processes. In this study, we investigated whether LINGO1 had a role in alveolar epithelial repair. A mouse alveolar epithelial cell line, MLE-12, was utilized in an in vitro scratch assay as a model of epithelial injury and repair. CRISPR/Cas9-mediated deletion of Lingo1 resulted in significantly reduced wound closure at both 24 and 48 h post-scratch in comparison to parental (WT) cells. We preformed RNA sequencing of 24h post-scratch cells or un-scratched cells, and revealed a set of 147 differentially expressed genes between WT and Lingo1KO cells following scratch.

ORGANISM(S): Mus musculus

PROVIDER: GSE180602 | GEO | 2024/07/21

REPOSITORIES: GEO

ACCESS DATA

Shared Molecules

Only show the datasets with similarity scores above: 0.5

Threshold

0.5

Similar Datasets

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.