Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: human coronavirus sequenced with random primer

PROVIDER: PRJNA1154272 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR30477182.fastq.gz	Fastqsanger.gz
	SRR30477183.fastq.gz	Fastqsanger.gz
	SRR30477184.fastq.gz	Fastqsanger.gz
	SRR30477185.fastq.gz	Fastqsanger.gz
	SRR30477186.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 7

Similar Datasets

Transcriptome sequencing Analysis of hLFSCs with and without mechanical stress

Project description:Purpose:The goals of this study are to MS (mechanical stress) how to change the cellular pathway of hLFSCs (human ligament flavum stem cells). Methods: Extract hLFSCs from the ligament flavum of patients.Treat the cells with and without (in control)MS.Total RNA was extracted from cells with Tripure Isolation Reagent.Subsequently, RNA was purified through rRNA depletion and then subjected to cDNA synthesis and RNA amplification. Next, random hexamer primer cDNA libraries were evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and sequenced on Illumina Hiseq 4000 sequencing platform (Illumina, San Diego, California, USA) following the manufacturer’s instructions for paired-end 150 bp reads (Lifegenes, Shanghai, China).

2021-10-13 | GSE185614 | GEO

Single cell RNA sequencing of iPSC and Human dermal fibroblasts

Project description:single cell RNA sequencing of iPSC and Human dermal fibroblasts using 10x Genomics with 3-prime, 5-prime poly(dT) primer, and 5-prime random primer. For comparison in gene, ncRNA and enhancer detection.

2021-05-13 | E-MTAB-10385 | biostudies-arrayexpress

circRNA Microarray for human colorectal adenocarcinoma and normal mucosa

Project description:Total RNA from each sample was quantified using the NanoDrop ND-1000. The sample preparation and microarray hybridization were performed based on the Arraystar’s standard protocols. Briefly, total RNA from each sample was amplified and transcribed into fluorescent cRNA utilizing random primer according to Arraystar’s Super RNA Labeling protocol (Arraystar Inc.). The labeled cRNAs were hybridized onto the Arraystar Human circRNA Array (8x15K, Arraystar). After having washed the slides, the arrays were scanned by the Agilent Scanner G2505C.

2020-02-05 | GSE138589 | GEO

Severe acute respiratory syndrome coronavirus 2

Project description:Severe acute respiratory syndrome coronavirus 2 Random survey

| PRJNA1149437 | ENA

Digital counting of nucleic acid molecules using random base molecular barcodes

Project description:Several template DNA molecules with random base molecular barcodes were amplified and sequenced, and the efficacy of the random base barcode for digital counting was shown.

2017-10-19 | GSE94895 | GEO

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Ab Initio Design of Amphipathic-Symmetric Peptides against SARS-CoV-2

Project description:Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) causes severe health crisis and huge socioeconomic upheaval internationally. This study proposes an ab initio design strategy to obtain antiviral peptides to against SARS-CoV-2 infection. The study employed database filtering technology to generate 7 amphipathic-symmetric peptides named DFTavPs with low cytotoxicity and random coil structure. Three DFTavPs promoted SARS-CoV-2 pseudoviruses infection and three DFTavPs inhibited virus infection, which are accompanied by up-regulation or down-regulation of SARS-CoV receptor angiotensin-converting enzyme 2 mRNA levels. Particularly, microRNA profiling showed that some differentially expressed microRNAs had potential to target key factors for cell entry of SARS-CoV-2. Furthermore, we explored the relationship of parameters and antiviral efficacy index (AEI). The results suggested that higher AEI of coronavirus was most likely to occur at mean amphipathic moment between 0.3 and 0.4. Automated machine learning was used to construct parameters-AEI regression models for various viruses. The Extra-Trees and CatBoost had a good predicting performance for AEI of coronavirus (R2=0.794 and Rpearson=0.897) and human immunodeficiency virus (R2=0.735 and Rpearson=0.859), respectively. Overall, this strategy is expected to efficiently obtain huge amounts of potential peptide drugs with anti-SARS-CoV-2 activity, and machine learning models could contribute to discovery of high antivirus-activity peptides.

2021-08-26 | GSE182562 | GEO

Transcriptomic analysis of the Novel Middle East Respiratory Syndrome Coronavirus (African green monkey, Vero E6 cells)

Project description:We will use the EMC/2012 strain of the novel beta Coronavirus called Middle East Respiratory Syndrome Coronavirus (MERS-CoV). It was initially passaged on Vero E6 cells in Saudi Arabia before being sequenced at the Erasmus Medical College in Rotterdam, Netherlands by Dr Ron Fouchier. We propose to perform a time course of infection of hCoV-EMC on MRC5 cells (Human Lung origin) and Vero cells (African Green Monkey Kidney cells). Both cell lines readily grow and replicate the virus. Importantly these cell lines show signs of Cytopathic effect (CPE), such as cell rounding and release from the petri dish that coincide with time points high virus replication demonstrating the effects of virus replication on the cells. Transcriptomic analysis will be performed after infection with MERS-CoV and SARS-CoV (Urbani strain) to compare the host gene induction that occurs during infection. MRC5 and Vero E6 cells will be infected at an MOI of 0.1 and 3 and RNA harvested from cells at 24 and 48 post infection. RNA will be processed for library creation and sequenced on an Illumina Hiseq. Sequencing reads will be analyzed and compared across the time course and between each virus to identify common response pathways induced during infection as well as unique pathways specific to each virus.

2015-11-19 | E-GEOD-56193 | biostudies-arrayexpress

Cell host-response to infection with novel human coronavirus EMC predict potential antivirals and important differences with SARS-coronavirus.

Project description:Differential expression was determined in Calu-3 cells between mock infected and infection with either Human coronavirus EMC and SARS coronavirus at different times post infection. Calu-3 2B4 cells were infected with Human Coronavirus EMC 2012 (HCoV-EMC) or mock infected. Samples were collected 0, 3, 7, 12, 18 and 24 hpi. There are 3 mock and 3 infected replicates for each time point, except for 12 hpi for which there are only 2 infected replicates (one replicate did not pass RNA quality check). There were no mock sampes at 18 hpi, and therefore infected samples at 18 hpi were compared with mocks at 24 hpi. For direct comparison with SARS-CoV infected cells, raw data from HCoV-EMC experiments were quantile normalized together with the SARS-CoV dataset (GEO Series accession number GSE33267).

2013-05-03 | E-GEOD-45042 | biostudies-arrayexpress

Light-Assisted Single-Stranded DNA Open-Chromatin Analysis in Single Spatially Localized Neuronal Cells Identifies the Capacity of Endogenous DNA to Act Catalytically [CHEX-seq]

Project description:We report a novel chromatin structure analysis technique, named "CHEX-seq" (CHromatin EXposed), which couples oligonucleotide random annealing and nucleus-resolution photoactivation such that the single-stranded open-chromatin DNA is copied, reverse transcribed, amplified and sequenced.

2023-10-19 | GSE231719 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data