Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profiling by miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

ABSTRACT: In order to define the cohort of miRNAs whose expression is regulated by METTL14 in p53 mutant colorectal cancer, we constructed HT29 cells stably infected with lentivirus carrying control transfectants (vector) or METTL14 overexpression (METTL14). Subsequently, total RNA was isolated and then performed miRNA Microarray.

ORGANISM(S): Homo sapiens

PROVIDER: GSE210044 | GEO | 2023/03/27

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Gene expression profiling by RNA-seq of control and METTL14-knockdown HT29 human colon cancer cells

Project description:In order to define the cohort of genes whose expression is regulated by METTL14 in p53 mutant colorectal cancer, we constructed HT29 cells stably infected with lentivirus carrying control shRNA (shNC) or METTL14 shRNA (shMETTL14). Subsequently, total RNA was isolated and then performed transcriptome RNA sequence.

2023-03-27 | GSE210045 | GEO

Gene expression profiling by RNA-seq of control and METTL14-knockdown HCT116 human colon cancer cells

Project description:In order to define the cohort of genes whose expression is regulated by METTL14 in p53 wild-type colorectal cancer, we constructed HCT116 cells stably infected with lentivirus carrying control shRNA (sh_NC) or METTL14 shRNA (sh_MET). Subsequently, total RNA was isolated and then performed transcriptome RNA sequence.

2023-03-27 | GSE186791 | GEO

RNA-seq and miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

Project description:RNA-seq and miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

| PRJNA863577 | ENA

Gene expression profiling by miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

Project description:Gene expression profiling by miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

| PRJNA863581 | ENA

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

Project description:Analysis of differentially expressed genes in colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours. Total RNA obtained from colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours.

2016-07-17 | E-GEOD-65979 | biostudies-arrayexpress

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

2020-08-13 | GSE65979 | GEO

Analysis of microRNA expression through microarray scan in HCT116 human colon cancer cells with or without METTL14 overexpression

Project description:To reveal the changes of miRNAs levels in HCT116 cells with METTL14 overexpression, we employed miRNA microarray expression profiling in HCT116 human colon cancer cells stably expressing control vector or METTL14.

2023-03-27 | GSE186790 | GEO

Gene expression profiling by RNA-seq of control and METTL14-knockdown HT29 human colon cancer cells

Project description:Gene expression profiling by RNA-seq of control and METTL14-knockdown HT29 human colon cancer cells

| PRJNA863580 | ENA

Diverse effect of WWOX overexpression in HT29 colon cancer cell line.

Project description:The WWOX gene is a tumor suppressor probably involved in regulation of cell cycle and apoptosis and downregulated in variety of cancer types.However, its role in colon cancerogenesis is unknown. The aim of this study was to characterize how WWOX may be involved in colon cancerogenesis or cancer progression, how it influences the basic cancer cell features and modifies cell expression profile.Our observations suggest that in HT29 colon cancer cell line increased expression of WWOX may result in transition of cancer cells into more normal- like colon epithelium phenotype, on the other hand in SW480 WWOX revealed the well-known tumour suppressor properties. However, as the colon cancer is very heterogeneous disease, obtained discrepancies may reflect the known differences between cell lines and cancerogenesis pathway, which they undergone. HT29 colon cancer cells were stably transfected with WWOX cDNA. HT29 cells transfected with an empty vector served as a control. Total mRNA was isolated to look for gene-expression differences induced by the WWOX overexpression.

2014-01-23 | E-GEOD-54298 | biostudies-arrayexpress

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data