Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profiling by RNA-seq of control and METTL14-knockdown HT29 human colon cancer cells

ABSTRACT: In order to define the cohort of genes whose expression is regulated by METTL14 in p53 mutant colorectal cancer, we constructed HT29 cells stably infected with lentivirus carrying control shRNA (shNC) or METTL14 shRNA (shMETTL14). Subsequently, total RNA was isolated and then performed transcriptome RNA sequence.

ORGANISM(S): Homo sapiens

PROVIDER: GSE210045 | GEO | 2023/03/27

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Gene expression profiling by miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

Project description:In order to define the cohort of miRNAs whose expression is regulated by METTL14 in p53 mutant colorectal cancer, we constructed HT29 cells stably infected with lentivirus carrying control transfectants (vector) or METTL14 overexpression (METTL14). Subsequently, total RNA was isolated and then performed miRNA Microarray.

2023-03-27 | GSE210044 | GEO

Gene expression profiling by RNA-seq of control and METTL14-knockdown HCT116 human colon cancer cells

Project description:In order to define the cohort of genes whose expression is regulated by METTL14 in p53 wild-type colorectal cancer, we constructed HCT116 cells stably infected with lentivirus carrying control shRNA (sh_NC) or METTL14 shRNA (sh_MET). Subsequently, total RNA was isolated and then performed transcriptome RNA sequence.

2023-03-27 | GSE186791 | GEO

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

Project description:Analysis of differentially expressed genes in colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours. Total RNA obtained from colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours.

2016-07-17 | E-GEOD-65979 | biostudies-arrayexpress

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

2020-08-13 | GSE65979 | GEO

Analysis of microRNA expression through microarray scan in HCT116 human colon cancer cells with or without METTL14 overexpression

Project description:To reveal the changes of miRNAs levels in HCT116 cells with METTL14 overexpression, we employed miRNA microarray expression profiling in HCT116 human colon cancer cells stably expressing control vector or METTL14.

2023-03-27 | GSE186790 | GEO

RNA-seq and miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

Project description:RNA-seq and miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

| PRJNA863577 | ENA

Expression data from human colon cancer cell line HCT116 with NFX1-91 knockdown and control cells

Project description:NFX1-91, a novel E6 cellular downstream target, functions as a transcriptional regulator and is involved in repressing hTERT expression. Other functions and downstream targets regulated by NFX1-91 were not well understood. We used microarrays to determine gene expression deregulated when NFX1-91 was knocked down. HCT116 cells was infected with lentivirus carrying NFX1-91 shRNA or control β-Galactosidase shRNA to stably knock down target gene expression. Total RNAs were extracted and hybridized on Affymetrix microarrays.

2010-08-18 | E-GEOD-23674 | biostudies-arrayexpress

Gene expression profiling by RNA-seq of control and METTL14-knockdown HT29 human colon cancer cells

Project description:Gene expression profiling by RNA-seq of control and METTL14-knockdown HT29 human colon cancer cells

| PRJNA863580 | ENA

Gene expression profiling by miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

Project description:Gene expression profiling by miRNA microarray of control and METTL14-overexpressed HT29 human colon cancer cells

| PRJNA863581 | ENA