Whole transcriptome analysis of neuroblastoma cell lines after ERK5 silencing
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE216790 | GEO | 2022/10/29
REPOSITORIES: GEO
Similar Datasets
Project description:Whole transcriptome analysis of neuroblastoma cell lines after ERK5 silencing
| PRJNA895405 | ENA
Project description:The transcriptomic network modulated after the inhibition of the nuclear tyrosin kinase ERK5 was analyzed Ishikawa endometroid cell line, in order to characterize and reveal any relevant role of this kinase at the transcriptional level.
2023-08-03 | GSE239920 | GEO
Project description:ERK5 is a dual kinase-transcription factor, which contains an N-terminal kinase domain and transactivation domains in the C-terminal half. Many ERK5 kinase inhibitors have been developed and tested to treat cancer and inflammatory diseases. However, recent data have raised questions regarding the functional role of ERK5 kinase inhibitors. We aimed to investigate how ERK5 reprograms myeloid cells (MC) to the senescence-associated secretory phenotype (SASP), consequently leading to atherosclerosis. We showed that atherosclerosis was inhibited in ERK5 S496A (dephosphorylation mimic) knock-in (KI) mice. Furthermore, ERK5 S496 phosphorylation was required for not only SASP but also senescence-associated cell growth (SACG) observed in the plaque via upregulation of aryl hydrocarbon receptor (AHR). We also discovered a key effect of ERK5 S496 phosphorylation on SUMOylation at a novel site of NRF2 (i.e., K518), which inhibited NRF2 transcriptional activity without affecting ERK5 kinase activity and antagonized oxidized LDL (oxLDL)-induced SASP. Specific ERK5 kinase inhibitors (AX15836 and XMD8-92) both inhibited oxLDL-induced ERK5 S496 phosphorylation, suggesting that ERK5 S496 phosphorylation was involved at least in part of the effects of these inhibitors. We have discovered a novel mechanism, in which ERK5 S496 phosphorylation directly inhibits NRF2 activity by upregulating NRF2 K518 SUMOylation, and induces SACG and atherosclerosis.
2023-06-09 | GSE210949 | GEO
Project description:Unlike other members of the MAPK family, ERK5 contains a large C-terminal domain with transcriptional activation capability in addition to an N-terminal canonical kinase domain. Genetic deletion of ERK5 is embryonic lethal and tissue-restricted deletions have profound effects on erythroid development, cardiac function and neurogenesis. In addition, depletion of ERK5 is anti-inflammatory and anti-tumorigenic. Small molecule inhibition of ERK5 has been shown to have promising activity in cell and animal models of inflammation and oncology. Here we report the synthesis and biological characterization of potent, selective ERK5 inhibitors. In contrast to both genetic depletion/deletion of ERK5 and inhibition with previously reported compounds, inhibition of the kinase with the most selective of the new inhibitors had no anti-inflammatory or anti-proliferative activity. The source of efficacy in previously reported ERK5 inhibitors is shown to be off-target activity on bromodomains (BRDs), conserved protein modules involved in recognition of acetyl-lysine residues during transcriptional processes. It is likely that phenotypes reported from genetic deletion or depletion of ERK5 arise from removal of a non-catalytic function of ERK5. The newly reported inhibitors should be useful in determining which of the many reported phenotypes are due to kinase activity, and delineate which can be pharmacologically targeted.
2016-09-09 | GSE86577 | GEO
Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.
2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress
Project description:Over the past few decades, interest in the role that extracellular signal-regulated kinase 5 (ERK5) plays in various diseases, particularly cancer and inflammation, has grown. Phenotypes observed from genetic knockdown or deletion of ERK5 suggested that targeting ERK5 could have therapeutic potential in various disease settings, motivating the development of potent and selective ATP-competitive ERK5 inhibitors. However, these inhibitors were unable to recapitulate the effects of genetic loss of ERK5, suggesting that ERK5 may have key kinase-independent roles. To investigate potential non-catalytic functions associated with ERK5, we report here the development of INY-06-061, a potent and selective heterobifunctional degrader of ERK5. In contrast to results reported through genetic knockdown of ERK5, INY-06-061-induced ERK5 degradation did not induce anti-proliferative effects in multiple cancer cell lines or suppress inflammatory responses in primary endothelial cells. Thus, we have developed and characterized a chemical tool useful for validating phenotypes reported to be associated with genetic ERK5 ablation and for guiding future ERK5-directed drug discovery efforts.
2022-10-13 | PXD036104 | Pride
Project description:Over the past few decades, interest in the role that extracellular signal-regulated kinase 5 (ERK5) plays in various diseases, particularly cancer and inflammation, has grown. Phenotypes observed from genetic knockdown or deletion of ERK5 suggested that targeting ERK5 could have therapeutic potential in various disease settings, motivating the development of potent and selective ATP-competitive ERK5 inhibitors. However, these inhibitors were unable to recapitulate the effects of genetic loss of ERK5, suggesting that ERK5 may have key kinase-independent roles. To investigate potential non-catalytic functions associated with ERK5, we report here the development of INY-06-061, a potent and selective heterobifunctional degrader of ERK5. In contrast to results reported through genetic knockdown of ERK5, INY-06-061-induced ERK5 degradation did not induce anti-proliferative effects in multiple cancer cell lines or suppress inflammatory responses in primary endothelial cells. Thus, we have developed and characterized a chemical tool useful for validating phenotypes reported to be associated with genetic ERK5 ablation and for guiding future ERK5-directed drug discovery efforts.
2022-10-13 | PXD036105 | Pride
Project description:Mutated KRAS serves as the oncogenic driver in 30% of non-small cell lung cancers (NSCLCs) and is associated with metastatic and therapy-resistant tumors. Focal Adhesion Kinase (FAK) acts as a mediator in sustaining KRAS-driven lung tumors, and although FAK inhibitors are currently undergoing clinical development, clinical data indicated that their efficacy in producing long-term anti-tumor responses is limited. Here we revealed two FAK interactors, extracellular-signal-regulated kinase 5 (ERK5) and cyclin-dependent kinase 5 (CDK5) as key players underlying FAK-mediated maintenance of KRAS mutant NSCLC. Inhibition of ERK5 and CDK5 synergistically suppressed FAK function, decreased proliferation and induced apoptosis owing to exacerbated ROS-induced DNA damage. Accordingly, concomitant pharmacological inhibition of ERK5 and CDK5 in a mouse model of KrasG12D-driven lung adenocarcinoma suppressed tumor progression and promoted cancer cell death. Cancer cells resistant to FAK inhibitors showed enhanced ERK5-FAK signaling dampening DNA damage. Notably, ERK5 inhibition prevents resistance to FAK inhibitors, significantly enhancing the efficacy of antitumor responses. Therefore, we propose ERK5 inhibition as a potential co-targeting strategy to counteract FAK inhibitor resistance in NSCLC.
2024-09-16 | GSE255643 | GEO
Project description:Mutated KRAS serves as the oncogenic driver in 30% of non-small cell lung cancers (NSCLCs) and is associated with metastatic and therapy-resistant tumors. Focal Adhesion Kinase (FAK) acts as a mediator in sustaining KRAS-driven lung tumors, and although FAK inhibitors are currently undergoing clinical development, clinical data indicated that their efficacy in producing long-term anti-tumor responses is limited. Here we revealed two FAK interactors, extracellular-signal-regulated kinase 5 (ERK5) and cyclin-dependent kinase 5 (CDK5) as key players underlying FAK-mediated maintenance of KRAS mutant NSCLC. Inhibition of ERK5 and CDK5 synergistically suppressed FAK function, decreased proliferation and induced apoptosis owing to exacerbated ROS-induced DNA damage. Accordingly, concomitant pharmacological inhibition of ERK5 and CDK5 in a mouse model of KrasG12D-driven lung adenocarcinoma suppressed tumor progression and promoted cancer cell death. Cancer cells resistant to FAK inhibitors showed enhanced ERK5-FAK signaling dampening DNA damage. Notably, ERK5 inhibition prevents resistance to FAK inhibitors, significantly enhancing the efficacy of antitumor responses. Therefore, we propose ERK5 inhibition as a potential co-targeting strategy to counteract FAK inhibitor resistance in NSCLC.
2024-09-16 | GSE255628 | GEO
Project description:Anaplastic Lymphoma Kinase (ALK) is a tyrosine kinase receptor which is a clinical target of major interest in cancer, including neuroblastoma. To better understand ALK signaling, three different neuroblastoma cell lines (CLB-BAR, CLB-GE and SK-N-AS) were cultured for 1hr and 24hrs in control conditions or after treatment with the ALK inhibitors crizotinib or lorlatinib. RNA-Seq experiments were performed to determine the expression changes resulting from ALK inhibition. Together with parallel phosphoproteomic experiments, these data unveil several important conserved oncogenic pathways in neuroblastoma.
2018-09-01 | E-MTAB-6654 | biostudies-arrayexpress