Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression data from preimplantation mouse embryos

ABSTRACT: Landmark events occur in a coordinated manner during preimplantation development of the mammalian embryo, yet the regulatory network that orchestrates these events remains largely unknown. We delineated the regulons of Oct4, Sall4, and Nanog using morpholino (MO)-mediated gene knockdowns followed by microarray analysis of pooled embryos.

ORGANISM(S): Mus musculus

PROVIDER: GSE42135 | GEO | 2012/11/09

SECONDARY ACCESSION(S): PRJNA179194

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Expression data from preimplantation mouse embryos

Project description:Landmark events occur in a coordinated manner during preimplantation development of the mammalian embryo, yet the regulatory network that orchestrates these events remains largely unknown. We delineated the regulons of Oct4, Sall4, and Nanog using morpholino (MO)-mediated gene knockdowns followed by microarray analysis of pooled embryos. 1-cell fertilized mouse embryos were injected with a morpholino and were collected at either 20 hours or at 44 hours after microinjection.

2012-11-09 | E-GEOD-42135 | biostudies-arrayexpress

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Transcriptome analysis of the Zebrafish model of Diamond-Blackfan Anemia from RPS19 deficiency via p53-dependent and -independent pathways

Project description:To determine the effect on the whole transcriptome of RPS19 morpholino and to identify the function of p53 in RPS19-deficient embryos, we analyzed the genome-wide transcript profiles of control morpholino (control), RPS19 morpholino knockdown (RPS19 MO), and RPS19 and p53 morpholino knockdown simultaneously (RPS19+p53 MO) using the Illumina Hi-seq 2000 Genome Analyzer platform with paired-end 100 base-pair tags to a depth of 35-60 million reads. We found that genes enriched in the functions of hematological systems and nervous system development and that skeletal and muscular disorders had significant differential expression in RPS19 MO embryos compared with controls. Co-inhibition of p53 partially alleviates the abnormalities for RPS19-deficient embryos. However, the hematopoietic genes, which were down-regulated significantly in RPS19 MO embryos, were not completely recovered by the co-inhibition of p53. Furthermore, we identified the genome-wide p53-dependent and -independent genes and pathways. These results indicate that not only p53 family members but also several other factors have important impacts on RPS19-deficient embryos. The detection of potential pathogenic genes and pathways provides us a new paradigm for research on DBA, which is a systematic and complex hereditary disease.

2013-10-09 | GSE45699 | GEO

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555 Two-condition experiment, slc2a10 MO (7.5ng) treatment vs control MO (5ng) treatment. Biological replicates: 3 slc2a10 MO replicates, compared to a pooled sample of 3 control MO replicates with dye swap.

2011-12-17 | E-GEOD-34508 | biostudies-arrayexpress

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

2011-12-17 | GSE34508 | GEO

Transcriptome analysis of the Zebrafish model of Diamond-Blackfan Anemia from RPS19 deficiency via p53-dependent and -independent pathways

2013-10-09 | E-GEOD-45699 | biostudies-arrayexpress

Transcription profiling of zebrafish embryos injected with a morpholino targeting LIN9

Project description:TÜAB zebrafish were maintained at 28.5 °C in in 1x Danieau solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca (NO3)2, 5 mM HEPES, pH 7.6, 0.0001 % Methylene blue). Morpholinos (Gene Tools, Philomath, OR) were designed against Danio rerio lin-9 homolog (Genebank accession NM_001044946). The morpholino (MO) sequences were MO-E1 5´-GTTAGTTTTATTACTCACTCTCGTC-3´ and 5-base mismatch morpholino MO-E1mis 5´-GTTACTTTTAATACTGACTGTCCTC-3´. 7 ng of morpholinos were injected into one cell-stage embryos. 20 embryos per condition (MO E1; MO E1mis) were pooled for RNA purification 24 h post fertilization. Using the two color Quick-Amp Labeling Kit (Agilent; 5190-0444) 100 ng of total RNA were used for cDNA synthesis, mRNA amplification and labeling according to manufacturers instructions. Transcriptional profiling was done on a zebrafish oligo array (Agilent; G2519F AMADID 019161) in a 4 x 44K slide format and analyzed as described before.<br>

2009-03-28 | E-MEXP-2100 | biostudies-arrayexpress

Zebrafish (Danio rerio) 72hpf, WT control vs. MO-Prpf31 injected

Project description:Transcriptional profiling performed from total eye RNA extracts of wildtype control fishes versus Prpf31 morpholino injected larvae (at ~72hpf) two-condition experiment: wildtype zebrafish versus MO-Prpf31 injected zebrafish eye RNA; 6 replicates each (extraction from 6 pools (~200 eyes each) of controls and 6 pools MO-Prpf31 (~200 eyes each))

2010-05-06 | E-GEOD-20424 | biostudies-arrayexpress

Cell fate roadmap of human primed-to-naive transition reveals preimplantation cell lineage signatures

Project description:We describe the global cell fate roadmap during primed-to-naive transition process by bulk mRNA-seq and ATAC-seq analysis among transition intermediates across different time points. We report that activation of ALPG is a landmark event for naive state establishment. Further investigation into transitioning cells with dynamic fluorescence presents intermediates branching into TE-like subpopulations with capacities of TSC derivation.

2022-04-29 | GSE174771 | GEO

Integration of tomato reproductive developmental landmarks and expression profiles, and the effect of SUN on fruit shape

Project description:Universally accepted landmark stages are necessary to highlight key events in tomato reproductive development. In this study, we provide a description of floral and fruit development in a red-fruited closely related wild relative of tomato, Solanum pimpinellifolium accession LA1589. We use established and propose new landmarks as the framework for the characterization of the tomato fruit shape gene SUN in fruit development. SUN controls fruit shape predominantly after fertilization and its effect reaches a maximum at 8 days post anthesis coinciding with fruit landmark 4 representing the globular embryo stage of seed development. We also analyzed gene expression profiles of floral buds 10 days before anthesis (floral landmark 7), anthesis-stage flowers (floral landmark 10 and fruit landmark 1), and 5 days post anthesis fruit (fruit landmark 3). The expression profiles of the NILs that differ at sun showed that 34 genes were differentially expressed and most of them at a less than 2-fold difference. However, many genes were differentially expressed between the developmental times points, including many genes involved in phytohormone biosynthesis or signaling as well as organ identity and patterning of tomato fruit. Three biological replicates were conducted with three sets of LA1589 sun NILs that differ at sun growing during different time periods resulting in 3 time points x 2 genotypes x 3 replicates = 18 array hybridizations.

2010-05-18 | E-GEOD-15453 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data