Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

DNA methylation analysis of the U937 cell line

ABSTRACT: DNA methylation profiling of gene promoters in the human myeloid cell line U937.

ORGANISM(S): Homo sapiens

PROVIDER: GSE60734 | GEO | 2014/09/26

SECONDARY ACCESSION(S): PRJNA259382

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

DNA methylation analysis of the U937 cell line

Project description:DNA methylation profiling of gene promoters in the human myeloid cell line U937. Bisulphite converted DNA from wildtype U937 cells was hybridised to the Illumina Infinium HumanMethylation27 BeadChip to determine the methylation pattern of the U937 cell line.

2014-09-26 | E-GEOD-60734 | biostudies-arrayexpress

Differential genomic-methylation profile of U937 cells transduced with WT/mutant-DNMT3A

Project description:DNA methyltransferase 3A (DNMT3A) gene is mutated in various myeloid neoplasms including acute myeloid leukemia (AML), especially at the Arg882 and associated with inferior outcomes. Despite the current progress of functional role of DNMT3A mutations, the molecular pathogenesis of myeloid malignancies remains poorly understood. The mechanisms of AML transformation and functional role of DNMT3A mutations through its target genes in the leukemogenesis remain to be explored. Here we wished to perform the differential genomic-methylation profile in U937 cells over-expressed with DNMT3A-Arg882His/Cys (R882H/C) mutations including DNMT3A-WT and vector using Illumina MethylationEPIC BeadChip microarray. Results: Differential genomic-methylation assess identified both hypo- and hypermethylation features in different regions throughout the whole genome of DNMT3A mutants-transduced U937 cells.

2017-12-01 | GSE90933 | GEO

Transcription profiling of U937 promonocytic cell line vs U937 promonocytic cell line, infected with wiltdype parvovirus H1 (H1_wt)

Project description:1) Ctrl Probe: U937 promonocytic cell line. 2) U937 promonocytic cell line, infected with wiltyp parvovirus H1 (H1_wt).

2013-01-30 | E-RZPD-4 | biostudies-arrayexpress

VCCS HEL and U937 cell line study: fresh and fixed cells

Project description:This study aims to determine the chromosome content and organisation of two myeloid leukaemia cell lines, HEL and U937. This will be done not only with SNP array data to determine breakpoints and copy number of copy number aberrations, but also with FISH (multicolour FISH, multicolour banding, centromere and single locus FISH) to identify translocation partners, chromosome organistion, centromere content, and provide some information on genome evolution in the cell line. Although several HEL SNP array karyotypes have been published and are available online the information here shows that there are some differences, and the additional FISH tests provide a greater depth of information on genome organisation and derivation of the abnormal chromosomes. The U937 cell line was also studied using DNA from fresh and fixed specimens for comparison of the quality of the SNP array data. Data from cells fixed using standard cytogenetic fixative (3:1 methanol:acetic acid) were compared to data from cells processed directly from tissue culture.

2013-11-30 | GSE41964 | GEO

Genes regulated after knock-down of Pirin in U937 cells

Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.

2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress

RNAseq of human monocyte cell line (U937-Cas9) WT or IRF2KO

Project description:We analyzed the transcriptional effect of IRF2 in the U937 human monocyte cell line. The major findings of the study is the regulation of CASP4 by IRF2

2019-09-05 | GSE132178 | GEO

Epigenome analysis of U937, U937 treated with 5mM azacytidine for 24 and 72 hours and its azacytidine-resistant derivative

Project description:Genome-wide DNA methylation profiling of U937 and its azacytidine-resistant derivative R-U937.

2013-07-01 | GSE45707 | GEO

Gene expression profile and DNA binding pattern of AML1/ETO in U937 cells

Project description:This SuperSeries is composed of the following subset Series: GSE10520: Genes regulated by AML1/ETO in U937 cells GSE10537: Gene expression profiling of AML1/ETO regulated genes and binding pattern on human promoters in U937 cells GSE10578: AML1/ETO, AML1, and HEB binding patterns on chromosme 19 GSE10579: Analysis of expression levels of genes on chromosome 19 in U937 cells expressing AML1/ETO Keywords: SuperSeries Refer to individual Series

2010-06-24 | E-GEOD-10537 | biostudies-arrayexpress

U937 treated with decitabine, panobinostat and valproic acid [Illumina]

Project description:We employed the AML cell line model U937 to determine the effects of single and dual treatment with the HMA decitabine and the HDACi Pano or VPA on gene expression and DNA methylation. We noted global alterations of gene expression and a massive effect on the methylome.

2016-05-12 | GSE81308 | GEO

Genes regulated after knock-down of Pirin in U937 cells

2009-12-10 | GSE16798 | GEO