IRF4, a master transcription factor, regulates genes involved in BCR signaling, antigen processing and presentation, and GC development
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE64270 | GEO | 2015/12/15
SECONDARY ACCESSION(S): PRJNA270587
REPOSITORIES: GEO
Similar Datasets
Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series
2015-12-15 | E-GEOD-64270 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâs lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. BL2 Burkitt's lymphoma-derived B cells were infected with lentivirus expressing shRNA for IRF4 or control, and total RNA was subjected to Illumina BeadsExpression Arrays analysis.
2015-12-15 | E-GEOD-64269 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).
2015-12-15 | E-GEOD-64268 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkitt’s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development.
2015-12-15 | GSE64269 | GEO
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkitt’s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development.
2015-12-15 | GSE64268 | GEO
Project description:In this study, we have used transcript profiling with microarrays in bone marrow-derived macrophages (BMDMs) to systematically identify genes transcriptionally regulated by IRF8 during ontogeny and maturation of macrophages, and in response of these cells to combined exposure to IFNgamma and Tlr9 ligand (CpG). For this, we used an experimental strategy based on the co-segregation of IRF8-dependent differential gene expression in macrophages from [BALB/c X BXH2] F2 animals selected for homozygosity for either wild type (wt; IRF8R294) or mutant (IRF8C294) IRF8 alleles. The study of IRF8-associated gene expression differences in individual animals of mixed genetic background, allows one to distinguish true IRF8-dependent effects on gene expression from unrelated differences in gene expression associated with intrinsic differences in genetic background but unrelated to IRF8.
2011-04-27 | E-MEXP-2962 | biostudies-arrayexpress
Project description:BackgroundActivation of naïve B lymphocytes by extracellular ligands, e.g. antigen, lipopolysaccharide (LPS) and CD40 ligand, induces a combination of common and ligand-specific phenotypic changes through complex signal transduction pathways. For example, although all three of these ligands induce proliferation, only stimulation through the B cell antigen receptor (BCR) induces apoptosis in resting splenic B cells. In order to define the common and unique biological responses to ligand stimulation, we compared the gene expression changes induced in normal primary B cells by a panel of ligands using cDNA microarrays and a statistical approach, CLASSIFI (Cluster Assignment for Biological Inference), which identifies significant co-clustering of genes with similar Gene Ontology annotation.ResultsCLASSIFI analysis revealed an overrepresentation of genes involved in ion and vesicle transport, including multiple components of the proton pump, in the BCR-specific gene cluster, suggesting that activation of antigen processing and presentation pathways is a major biological response to antigen receptor stimulation. Proton pump components that were not included in the initial microarray data set were also upregulated in response to BCR stimulation in follow up experiments. MHC Class II expression was found to be maintained specifically in response to BCR stimulation. Furthermore, ligand-specific internalization of the BCR, a first step in B cell antigen processing and presentation, was demonstrated.ConclusionThese observations provide experimental validation of the computational approach implemented in CLASSIFI, demonstrating that CLASSIFI-based gene expression cluster analysis is an effective data mining tool to identify biological processes that correlate with the experimental conditional variables. Furthermore, this analysis has identified at least thirty-eight candidate components of the B cell antigen processing and presentation pathway and sets the stage for future studies focused on a better understanding of the components involved in and unique to B cell antigen processing and presentation.
| S-EPMC1479375 | biostudies-literature
Project description:Methamphetamine (Meth) is abused by over 35 million people worldwide. Chronic Meth abuse may be particularly devastating in individuals who engage in unprotected sex with multiple partners because it is associated with a 2-fold higher risk for obtaining HIV and associated secondary infections. We report the first specific evidence that Meth at pharmacological concentrations exerts a direct immunosuppressive effect on dendritic cells and macrophages. As a weak base, Meth collapses the pH gradient across acidic organelles, including lysosomes and associated autophagic organelles. This in turn inhibits receptor-mediated phagocytosis of antibody-coated particles, MHC class II antigen processing by the endosomal-lysosomal pathway, and antigen presentation to splenic T cells by dendritic cells. More importantly Meth facilitates intracellular replication and inhibits intracellular killing of Candida albicans and Cryptococcus neoformans, two major AIDS-related pathogens. Meth exerts previously unreported direct immunosuppressive effects that contribute to increased risk of infection and exacerbate AIDS pathology.
| S-EPMC2242831 | biostudies-literature
Project description:In order to fulfil the special requirements of antigen-specific activation and communication with other immune cells, B lymphocytes require finely regulated endosomal vesicle trafficking. How the endosomal machinery is regulated in B cells remains largely unexplored. In our previous proximity proteomic screen, we identified the SNARE protein Vti1b as one of the strongest candidates getting accumulated to the sites of early BCR activation. In this report, we follow up on this finding and investigate the localisation and function of Vti1b in B cells. We found that GFP-fused Vti1b was concentrated at the Golgi complex, around the MTOC, as well as in the Rab7+ lysosomal vesicles in the cell periphery. Upon BCR activation with soluble antigen, Vti1b showed partial localization to the internalized antigen vesicles, especially in the periphery of the cell. Moreover, upon BCR activation using surface-bound antigen, Vti1b polarised to the immunological synapse, colocalising with the Golgi complex, and with lysosomes at actin foci. To test for a functional role of Vti1b in early B cell activation, we used primary B cells isolated from Vit1b-deficient mouse. However, we found no functional defects in BCR signalling, immunological synapse formation, or processing and presentation of the internalized antigen, suggesting that the loss of Vti1b in B cells could be compensated by its close homologue Vti1a or other SNAREs.
| S-EPMC9468668 | biostudies-literature
Project description:MicroRNAs (miRNAs) mediate the regulation of gene expression. Several reports indicate that probiotics induce miRNA-mediated immunomodulation at different levels, such as cytokine production and the up-regulation of several markers related to antigen presentation in antigen-presenting cells. The objective of this work was to identify target genes of miRNAs that are involved in the processing and presentation of antigens in monocyte-derived dendritic cells (moDCs) stimulated with the probiotic Bifidobacterium animalis ssp. lactis BB12 (BB12). First, an in silico prediction analysis for a putative miRNA binding site within a given mRNA target was performed using RNAHybrid software with mature sequences of differentially expressed miRNAs retrieved from a Genbank data set that included BB12-stimulated and unstimulated porcine monocytes. From them, 23 genes resulted in targets of 19 miRNAs, highlighting miR-30b-3p, miR-671-5p, and miR-9858-5p, whose targets were costimulatory molecules, and were overexpressed (p < 0.05) in BB12-stimulated moDCs. The analysis of moDCs showed that the percentage of cells expressing SLA-DR+CD80+ decreased significantly (p = 0.0081) in BB12-stimulated moDCs; interleukin (IL)-10 production was unchanged at 6 h but increased after 24 h of culture in the presence of BB12 (p < 0.001). In summary, our results suggest that SLA-DR and CD80 can be down-regulated by miRNAs miR-30b-3p, miR-671-5p, and miR-9858-5p, while miR-671-5p targets IL-10.
| S-EPMC7037397 | biostudies-literature