Dataset Information

Components of the antigen processing and presentation pathway revealed by gene expression microarray analysis following B cell antigen receptor (BCR) stimulation.

ABSTRACT: BACKGROUND: Activation of naïve B lymphocytes by extracellular ligands, e.g. antigen, lipopolysaccharide (LPS) and CD40 ligand, induces a combination of common and ligand-specific phenotypic changes through complex signal transduction pathways. For example, although all three of these ligands induce proliferation, only stimulation through the B cell antigen receptor (BCR) induces apoptosis in resting splenic B cells. In order to define the common and unique biological responses to ligand stimulation, we compared the gene expression changes induced in normal primary B cells by a panel of ligands using cDNA microarrays and a statistical approach, CLASSIFI (Cluster Assignment for Biological Inference), which identifies significant co-clustering of genes with similar Gene Ontology annotation. RESULTS: CLASSIFI analysis revealed an overrepresentation of genes involved in ion and vesicle transport, including multiple components of the proton pump, in the BCR-specific gene cluster, suggesting that activation of antigen processing and presentation pathways is a major biological response to antigen receptor stimulation. Proton pump components that were not included in the initial microarray data set were also upregulated in response to BCR stimulation in follow up experiments. MHC Class II expression was found to be maintained specifically in response to BCR stimulation. Furthermore, ligand-specific internalization of the BCR, a first step in B cell antigen processing and presentation, was demonstrated. CONCLUSION: These observations provide experimental validation of the computational approach implemented in CLASSIFI, demonstrating that CLASSIFI-based gene expression cluster analysis is an effective data mining tool to identify biological processes that correlate with the experimental conditional variables. Furthermore, this analysis has identified at least thirty-eight candidate components of the B cell antigen processing and presentation pathway and sets the stage for future studies focused on a better understanding of the components involved in and unique to B cell antigen processing and presentation.

SUBMITTER: Lee JA

PROVIDER: S-EPMC1479375 | biostudies-literature | 2006

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Components of the antigen processing and presentation pathway revealed by gene expression microarray analysis following B cell antigen receptor (BCR) stimulation.

Lee Jamie A JA Sinkovits Robert S RS Mock Dennis D Rab Eva L EL Cai Jennifer J Yang Peng P Saunders Brian B Hsueh Robert C RC Choi Sangdun S Subramaniam Shankar S Scheuermann Richard H RH

BMC bioinformatics 20060502

<h4>Background</h4>Activation of naïve B lymphocytes by extracellular ligands, e.g. antigen, lipopolysaccharide (LPS) and CD40 ligand, induces a combination of common and ligand-specific phenotypic changes through complex signal transduction pathways. For example, although all three of these ligands induce proliferation, only stimulation through the B cell antigen receptor (BCR) induces apoptosis in resting splenic B cells. In order to define the common and unique biological responses to ligand ...[more]

PMID: 16670020

Similar Datasets

Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65Â°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65Â°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37Â°C. Finally, proteinase K (400 Î¼g of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45Â°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16Â°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94Â°C, 30 cycles of 30 sec at 94Â°C, 30 sec at 53Â°C, 30 sec at 72Â°C, and 10 min at 72Â°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).

Dataset Information

Components of the antigen processing and presentation pathway revealed by gene expression microarray analysis following B cell antigen receptor (BCR) stimulation.

Publications

Components of the antigen processing and presentation pathway revealed by gene expression microarray analysis following B cell antigen receptor (BCR) stimulation.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets