GNPS - SEED Covian Mouse Fecal
Ontology highlight
ABSTRACT:
INSTRUMENT(S): maXis
ORGANISM(S): Mus Musculus (ncbitaxon:10090)
SUBMITTER: 
Peter Ernst
PROVIDER: MSV000083302 | GNPS | Mon Jan 07 15:20:00 GMT 2019
REPOSITORIES: GNPS
Shared Molecules
Only show the datasets with similarity scores above: 0.5
Threshold
0.5
Similar Datasets
Project description:Bovine respiratory epithelial cells have different susceptibility to bovine
respiratory syncytial virus infection. The cells derived from the lower
respiratory tract were significantly more susceptible to the virus than those
derived from the upper respiratory tract. Pre-infection with virus of lower
respiratory tract with increased adherence of P. multocida; this was not the
case for upper tract. However, the molecular mechanisms of enhanced
bacterial adherence are not completely understood. To investigate whether
virus infection regulates the cellular adherence receptor on bovine trachea-,
bronchus- and lung-epithelial cells, we performed proteomic analyses.
2020-07-28 | PXD019509 | JPOST Repository
Project description:<p>Accurate tests for microbiologic diagnosis of lower respiratory tract infections (LRTI) are needed. Gene expression profiling of whole blood represents a powerful new approach for analysis of the host response during respiratory infection that can be used to supplement pathogen detection testing. Using qPCR, we prospectively validated the differential expression of 10 genes previously shown to discriminate bacterial and non-bacterial LRTI confirming the utility of this approach. In addition, a novel approach using RNAseq analysis identified 141 genes differentially expressed in LRTI subjects with bacterial infection. Using "pathway-informed" dimension reduction, we identified a novel 11 gene set (selected from lymphocyte, α-linoleic acid metabolism, and IGF regulation pathways) and demonstrated a predictive accuracy for bacterial LRTI (nested CV-AUC=0.87). RNAseq represents a new and an unbiased tool to evaluate host gene expression for the diagnosis of LRTI.</p>
| phs001248 | dbGaP
Project description:After DNA damage, cells activate p53, a tumor suppressor gene, and select a cell fate (e.g., DNA repair, cell cycle arrest, or apoptosis). Recently, a p53 oscillatory behavior was observed following DNA damage. However, the relationship between this p53 oscillation and cell-fate selection is unclear. Here, we present a novel model of the DNA damage signaling pathway that includes p53 and whole cell cycle regulation and explore the relationship between p53 oscillation and cell fate selection. The simulation run without DNA damage qualitatively realized experimentally observed data from several cell cycle regulators, indicating that our model was biologically appropriate. Moreover, the comprehensive sensitivity analysis for the proposed model was implemented by changing the values of all kinetic parameters, which revealed that the cell cycle regulation system based on the proposed model has robustness on a fluctuation of reaction rate in each process. Simulations run with four different intensities of DNA damage, i.e. Low-damage, Medium-damage, High-damage, and Excess-damage, realized cell cycle arrest in all cases. Low-damage, Medium-damage, High-damage, and Excess-damage corresponded to the DNA damage caused by 100, 200, 400, and 800 J/m(2) doses of UV-irradiation, respectively, based on expression of p21, which plays a crucial role in cell cycle arrest. In simulations run with High-damage and Excess-damage, the length of the cell cycle arrest was shortened despite the severe DNA damage, and p53 began to oscillate. Cells initiated apoptosis and were killed at 400 and 800 J/m(2) doses of UV-irradiation, corresponding to High-damage and Excess-damage, respectively. Therefore, our model indicated that the oscillatory mode of p53 profoundly affects cell fate selection.
2024-09-02 | BIOMD0000000939 | BioModels
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Parkinson’s disease (PD) is characterized by a protracted period of non-motor symptoms, including gastrointestinal (GI) dysfunction, which can precede the development of cardinal motor dysfunction by decades. This long prodrome of disease is highly suggestive of immune cell involvement in the initiation of disease, but currently the field lacks robust modeling systems to study such mechanisms. The leading hypotheses for the origin of PD, known as the Braak’s hypothesis, states that pathology is first initiated in the GI tract due to environmental triggers, such as pathogens that enter the GI tract in genetically predisposed individuals. Our group has developed GI-targeted pathogen-induced PD mouse modeling systems (in PINK1 KO mice with gram negative bacterial infections) and found that T cells are a major player in driving PD-like motor symptoms at late stages following infection. Herein, we now map the initiating immune events at the site of infection at the earliest stages with the goal of shedding light on the earliest mechanisms triggering T cell-mediated pathological processes relevant to PD. Using unbiased single cell sequencing, we demonstrate that myeloid cells are the earliest dysregulated immune cell type in PINK1 KO infected mice (at 1-week post-infection) followed by a dysregulated T cell response shortly after (at 2 weeks post-infection). We find that these myeloid cells have an enhanced proinflammatory profile, are more mature, and develop enhanced capacity for antigen presentation. Using unbiased prediction analysis, our data suggests that cytotoxic T cells and myeloid cells are particularly poised for interacting with each other, and we identify possible direct cell-cell interaction pathways that might be implicated. How or if these early aberrant immune responses play a key role in initiating PD autoimmunity is the subject of further investigation.
2024-08-08 | GSE271210 | GEO
Project description:The inflammatory response initiated by microbial products signaling through Toll-like receptors (TLRs) of the innate immune system is essential for host defense against infection. Because inflammation can be harmful to host tissues, the innate response is highly regulated. Negative regulation of TLR4, the receptor for bacterial lipopolysaccharide (LPS), results in LPS tolerance, defined as hyporesponsiveness to repeated stimulation with LPS. LPS tolerance is thought to protect the host from excessive inflammation by turning off TLR4 signal, which then shuts down TLR-induced genes. However, TLR signaling induces hundreds of genes with very different functions. We reasoned that genes with different functions should have different requirements for regulation. Specifically, genes encoding proinflammatory mediators should be transiently inactivated to limit tissue damage, while genes encoding antimicrobial effectors, which directly target pathogens, should remain inducible in tolerant cells to protect the host from infection. Using an in vitro system of LPS tolerance in macrophages, here we show that TLR-induced genes may indeed be divided into two distinct categories based on their functions and regulatory requirements. Further, we show these distinct groups are regulated by gene-specific, and not signal-specific mechanisms. Experiment Overall Design: We examined gene expression using affymetrix genechips in 3 groups of murine bone-marrow derived macrophages: Naive (untreated), Naive stimulated with LPS, and Tolerant stimulated with LPS. Two biological replicates were performed for each group.
2008-06-15 | E-GEOD-7348 | biostudies-arrayexpress
Project description:Necrotizing enterocolitis (NEC) is an acute and life-threatening gastrointestinal disorder afflicting preterm infants, which is currently unpreventable. Fecal microbiota transplantation (FMT) is a promising preventative therapy, but potential bacterial infection raise concern. Removal of bacteria from donor feces may reduce this risk while maintaining the NEC-preventive effects. We aimed to assess preclinical efficacy and safety of bacteria-free fecal filtrate transfer (FFT). Using fecal material from healthy suckling piglets, we administered FMT rectally, or cognate FFT either rectally or oro-gastrically to formula-fed preterm, cesarean-delivered piglets as a model for preterm infants, We compared gut pathology and related safety parameters with saline controls, and analyzed ileal mucosal transcriptome to gauge the host e response to FMT and FFT treatments relative to control. Results showed that oro-gastric FFT prevented NEC, whereas FMT did not perform better than control. Moreover, FFT but not FMT reduced intestinal permeability, whereas FMT animals had reduced body weight increase and intestinal growth. Global gene expression of host mucosa responded to FMT but not FFT with increased and decreased bacterial and viral defense mechanisms, respectively. In conclusion, as preterm infants are extremely vulnerable to enteric bacterial infections, rational NEC-preventive strategies need incontestable safety profiles. Here we show in a clinically relevant animal model that FFT, as opposed to FMT, efficiently prevents NEC without any recognizable side effects. If translatable to preterm infants, this could lead to a change of practice and in turn a reduction in NEC burden.
2021-10-01 | GSE158878 | GEO
Project description:Understanding predator guild niche partitioning using DNA metabarcoding
| PRJNA1103791 | ENA
Project description:Viral infections facilitate bacterial trafficking to the lower respiratory tract resulting in bacterial viral co infections. Bacterial dissemination to the lower respiratory tract is enhanced by influenza A virus induced epithelial cell damage and dysregulation of immune responses. Epithelial cells act as the first line of defense and detect pathogens by a high variety of pattern recognition receptors. The post translational modification ubiquitin is involved in almost every cellular process. Moreover, ubiquitination contributes to the regulation of host immune responses, influenza A virus uncoating and transport within host cells. We applied proteomics with a special focus on ubiquitination to assess the impact of single bacterial and viral as well as bacterial viral co-infections on bronchial epithelial cells. We used Tandem Ubiquitin Binding Entities to enrich polyubiquitinated proteins and assess changes in the ubiquitinome. Infecting 16HBE cells with Streptococcus pyogenes led to an increased abundance of proteins related to mitochondrial translation and energy metabolism in proteome and ubiquitinome. In contrast, influenza A virus infection mainly altered the ubiquitinome. Co-infections had no additional impact on protein abundances or affected pathways. Changes in protein abundance and enriched pathways were assigned to imprints of both infecting pathogens.
2022-06-13 | PXD026625 | panorama