The Chromatin Reader ZMYND8 Regulates Igh Enhancers to Promote Immunoglobulin Class Switch Recombination
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA486811 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR7722950.fastq.gz | Fastqsanger.gz | |||
| SRR7722960.fastq.gz | Fastqsanger.gz | |||
| SRR7722970.fastq.gz | Fastqsanger.gz | |||
| SRR7722980.fastq.gz | Fastqsanger.gz | |||
| SRR7722951.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 44 |
Similar Datasets
Project description:Class Switch Recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3’ Igh super-enhancer, 3’ Regulatory Region (3’RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here we identify the chromatin reader ZMYND8 as an essential regulator of the 3’RR and CSR. In B cells, ZMYND8 binds promoters and super-enhancers, including the 3’RR, and controls its activity by modulating the enhancer transcriptional status. In its absence, there is increased 3’RR polymerase loading, and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3’RR. Thus ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3’ Igh super-enhancer.
2018-10-04 | GSE118794 | GEO
Project description:Class switch recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3' Igh super-enhancer, 3' regulatory region (3'RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here, we identify the chromatin reader ZMYND8 as an essential regulator of the 3'RR. In B cells, ZMYND8 binds promoters and super-enhancers, including the Igh enhancers. ZMYND8 controls the 3'RR activity by modulating the enhancer transcriptional status. In its absence, there is increased 3'RR polymerase loading and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3'RR. Thus, ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3' Igh super-enhancer.
| S-EPMC6242708 | biostudies-literature
Project description:Class Switch Recombination (CSR) is a B cell specific genomic alteration induced by activation induced cytidine deaminase (AID)-dependent DNA break, followed by repair and recombination at the immunoglobulin heavy-chain locus. The involvement of several chromatin-associated factors in promoting AID-induced DNA break formation has been reported. However, the involvement of chromatin adaptors at the repair phase of CSR remains unknown. Here, we provide evidence that acetylated histone reader Brd4 is critical to the repair and recombination step of CSR. Brd4 was recruited to the AID-induced DNA break region, and depletion of Brd4 from the S region chromatin by knockdown or a chemical inhibitor JQ1 causes CSR impairment without affecting AID-induced DNA break generation. Such inhibition of Brd4 suppressed the accumulation of 53BP1 and UNG at the cleaved S regions, perturbed switch donor-switch acceptor microhomology length and reduced Igh/c-myc translocation. We conclude that Brd4 serves as a histone-reader platform required for the recruitment of CSR repair components. Brd4 were depleted from the chromatin by either siRNA treatment or JQ1 (40nM) addition in CH12F3-2A cells in the presence of CIT stimulation. RNA from each samples were extracted and relative difference in transcript level were compared with control RNAi- and DMSO-treated, CIT-stimulated samples.
2014-06-20 | E-GEOD-52239 | biostudies-arrayexpress
Project description:Class Switch Recombination (CSR) is a B cell specific genomic alteration induced by activation induced cytidine deaminase (AID)-dependent DNA break, followed by repair and recombination at the immunoglobulin heavy-chain locus. The involvement of several chromatin-associated factors in promoting AID-induced DNA break formation has been reported. However, the involvement of chromatin adaptors at the repair phase of CSR remains unknown. Here, we provide evidence that acetylated histone reader Brd4 is critical to the repair and recombination step of CSR. Brd4 was recruited to the AID-induced DNA break region, and depletion of Brd4 from the S region chromatin by knockdown or a chemical inhibitor JQ1 causes CSR impairment without affecting AID-induced DNA break generation. Such inhibition of Brd4 suppressed the accumulation of 53BP1 and UNG at the cleaved S regions, perturbed switch donor-switch acceptor microhomology length and reduced Igh/c-myc translocation. We conclude that Brd4 serves as a histone-reader platform required for the recruitment of CSR repair components.
2014-06-20 | GSE52239 | GEO
Project description:Programmed genetic rearrangements in lymphocytes require transcription at antigen receptor genes to promote accessibility for initiating double-strand break (DSB) formation critical for DNA recombination and repair. Here we show that activated B cells deficient in the PTIP component of the MLL3 (mixed-lineage leukemia 3) /MLL4 complex display impaired histone methylation (H3K4me3) and transcription initiation of downstream switch regions at the immunoglobulin heavy-chain (Igh) locus leading to defective immunoglobulin class-switching. We also show that PTIP accumulation at DSBs contributes to class-switch recombination (CSR) and genome stability independently from Igh switch transcription. These results demonstrate that PTIP promotes specific chromatin changes that control the accessibility of the Igh locus to CSR, and suggest a non-redundant role for the MLL3/MLL4 complex in altering antibody effector function. Genome-wide analysis of histone modifications, PTIP, and Pol II in PTIP-WT and PTIP-KO mouse activated B cells.
2010-08-25 | E-GEOD-20852 | biostudies-arrayexpress
Project description:Programmed genetic rearrangements in lymphocytes require transcription at antigen receptor genes to promote accessibility for initiating double-strand break (DSB) formation critical for DNA recombination and repair. Here we show that activated B cells deficient in the PTIP component of the MLL3 (mixed-lineage leukemia 3) /MLL4 complex display impaired histone methylation (H3K4me3) and transcription initiation of downstream switch regions at the immunoglobulin heavy-chain (Igh) locus leading to defective immunoglobulin class-switching. We also show that PTIP accumulation at DSBs contributes to class-switch recombination (CSR) and genome stability independently from Igh switch transcription. These results demonstrate that PTIP promotes specific chromatin changes that control the accessibility of the Igh locus to CSR, and suggest a non-redundant role for the MLL3/MLL4 complex in altering antibody effector function.
2010-08-25 | GSE20852 | GEO
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:Activation of splenic B cells induces formation of a 220kb DNA loop between Em and 3â??RR enhancers in the immunoglobulin heavy chain locus (IgH). This DNA loop has been proposed to be necessary for the crucial immune diversification mechanism of IgH class switch recombination, but the factors that control its formation are unknown. We show that conditional deletion of transcription factor YY1 in primary splenic B cells results in a dramatic drop in formation of this DNA loop, as well as immunoglobulin class switch recombination. Reconstitution of YY1-deleted splenic B cells with various YY1 mutants showed that the C-terminal half of YY1 lacking the transactivation domain restored both Em-3â??RR DNA loop formation as well as class switch recombination. RNA transcript analyses of YY1 conditional deleted splenic B cells suggest that YY1 does not regulate genes needed for DNA looping or CSR. Our results argue for a direct physical mechanism of YY1 mediating long-distance DNA loops and provide strong evidence of the importance of this DNA loop for class switching. Our results provide foundational mechanistic insight into a crucial immune function. Follicular B cells were isolated from the spleens of three C57Bl/6 yy1 fl/fl mice. For each spleen, half the cells received mock treatment and half received TATCRE. The 6 samples were then grown in RPMI medium along with LPS, Il4, OPI, and 20% FBS for 72 hours. The 6 groups of cells were lysed and RNA was isolated for library preparation. Expression differences between Mock and TATCRE treated cells were determined to understand the role of yy1 in B cell class switching.
2016-08-06 | E-GEOD-85259 | biostudies-arrayexpress
Project description:Activation of splenic B cells induces formation of a 220kb DNA loop between Em and 3’RR enhancers in the immunoglobulin heavy chain locus (IgH). This DNA loop has been proposed to be necessary for the crucial immune diversification mechanism of IgH class switch recombination, but the factors that control its formation are unknown. We show that conditional deletion of transcription factor YY1 in primary splenic B cells results in a dramatic drop in formation of this DNA loop, as well as immunoglobulin class switch recombination. Reconstitution of YY1-deleted splenic B cells with various YY1 mutants showed that the C-terminal half of YY1 lacking the transactivation domain restored both Em-3’RR DNA loop formation as well as class switch recombination. RNA transcript analyses of YY1 conditional deleted splenic B cells suggest that YY1 does not regulate genes needed for DNA looping or CSR. Our results argue for a direct physical mechanism of YY1 mediating long-distance DNA loops and provide strong evidence of the importance of this DNA loop for class switching. Our results provide foundational mechanistic insight into a crucial immune function.
2016-08-06 | GSE85259 | GEO
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR.
2016-02-17 | GSE62969 | GEO