Ontology highlight
ABSTRACT:
PROVIDER: PRJNA453807 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Prostate of SD rats was injected with 0.1 ml 1% carrageenan to induce chronic nonbacterial prostatitis, and the control rats injected with sterile saline. Then, the cecal contents were collected for 16S rDNA sequencing.
2021-07-07 | GSE179639 | GEO
Project description:Microplastics (MPs) as widespread contamination pose high risk for aquatic organisms.Intestinal microbiotahas have high interaction with immune system of host body. In this study, intestinal microbiota of zebrafish after Polystyrene (PS-MPs) exposure were characterized by 16S rDNA amplicon sequencing. We found that 100nm and 200μm PS-MPs exposure significantly increased diversity of intestinal microbiota and all the three sizes of PS-MPs increased abundance of pathogenic bacteria.
2019-10-01 | GSE136108 | GEO
Project description:Eriocitrin, found in lemon fruit, has shown a wide range of biological properties. Herein, to evaluate the intestinal metabolic profile of eriocitrin in colon, the flavonoids in mice colon contents were identified by ultra performance liquid chromatography-electrospray ionization-tandem mass spectrometry (UPLC-ESI-MS/MS), and a total of 136 flavonoids were found, including eriocitrin and its six metabolites (eriodictyol, homoeriodictyol, hesperetin, eriodictyol-3'-O-glucoside, hesperetin-7-O-glucoside and eriodictyol-7-O-(6''-O-galloyl) glucoside). Mice colon contents were used for 16S rDNA gene sequencing and gas chromatography-mass (GC-MS). Resultu showed that eriocitrin significantly alters the beta diversity of the gut microbiota, the probiotics such as Lachnospiraceae_UCG_006 were significantly enriched, and the production of butyrate, valerate and hexanoate in the colon pool of short-chain fatty acids (SCFAs) were significant increased. The spearman's association analysis performed some intestinal bacteria may be involved in the metabolism of eriocitrin. Collectively, our results preliminarily suggesting the metabolism of eriocitrin in the gut, demonstrate alterations of eriocitrin on gut microbiota, which warrants further investigation to determine its potential use in food and biomedical applications.
2022-11-30 | GSE218729 | GEO
Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.
2017-03-31 | PXD004911 | Pride
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:16S rDNA amplicon sequencing of 196 human fecal samples of an Inulin cross-over trial in healthy, mildly constipated individuals.
| EGAD00001004956 | EGA
Project description:In the DSS-induced colitis model, the epithelial damage and resulting inflammation is restricted to the colon, with a potential influence on the microbial composition in the adjacent cecum. Several studies have reported changes of the gut microbiota in the DSS-induced colitis model and other mouse models of IBD. Furthermore, metaproteomics analysis of the gut microbiome in a mouse model of Crohn’s disease demonstrated that disease severity and location are microbiota-dependent, with clear evidence for the causal role of bacterial dysbiosis in the development of chronic ileal inflammation. We have developed a refined model of chronic DSS-induced colitis that reflects typical symptoms of human IBD without a risky body weight loss usually observed in DSS models [Hoffmann et al., submitted]. In this study, we used metaproteomics to characterize the disease-related changes in bacterial protein abundance and function in the refined model of DSS-induced colitis. To assess the structural and functional changes, we applied 16S rRNA gene sequencing and metaproteomics analysis of the intestinal microbiota in three different entities of the intestinal environment, i.e. colon mucus, colon content and cecum content.
2020-03-17 | PXD007220 | Pride
Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.
2022-04-13 | GSE182457 | GEO