Ontology highlight
ABSTRACT:
PROVIDER: PRJNA725645 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR14339774_1.fastq.gz | Fastqsanger.gz | |||
| SRR14339774_2.fastq.gz | Fastqsanger.gz | |||
| SRR14339775_1.fastq.gz | Fastqsanger.gz | |||
| SRR14339775_2.fastq.gz | Fastqsanger.gz | |||
| SRR14339776_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 16 |
Similar Datasets
Project description:To explore the diversity and phylogeny of comammox communities in six mangrove ecosystems across southeastern China based on amoA genes through high-throughput sequencing.
| OEX003835 | NODE
Project description:tsRNA is newly found small non-coding RNA with important biological function. However, the knowlede of diversity, biogeneis and function of tsRNA in plant is still lacking. Here, we selected 10-60 nt small RNA for high-throughput sequencing and uncovered the diversity,biogenesis and potentical function of tsRNA in Arabidopsis.
2021-03-07 | GSE95768 | GEO
Project description:This study was designed to explore the role of LINC02015 in regulating biological behaviors of vascular smooth muscle cells (VSMCs) and investigate the interacting targets of LINC02015 with high-throughput techniques and bioinformatics analysis. Chromatin isolation by RNA purification (ChIRP) sequencing was applied to explore the interaction relationship among LncRNA, RNA-binding protein and DNA. Localization of the active binding sites was specified by high-throughput sequencing with STAR2. Peak calling analysis was applied to spot enriched gene peaks with MACS.
2021-11-16 | GSE188751 | GEO
Project description:As part of the ENCODE consortium, the GENCODE project is producing a reference gene set through manual and automated gene prediction. Selected transcript models are verified experimentally by RT-PCR amplification of at least one of their unique splice junctions, followed by high-throughput sequencing (RT-PCR-seq). The experimental targets are manually annotated transcripts with novel or putative status, non-pseudogene biotype, and unique splice junctions which have not been validated previously and are not supported by RNAseq data from the ENCODE and GTEx projects. For Batch XVII, 1159 splice junctions which failed this experimental verification in previous experiments were tested again. On this occasion, newly designed PCR primers were used and compared with the original ones. In addition, the original tissue panel was widened with the inclusion of eight new tissues.
2017-03-31 | E-MTAB-5527 | biostudies-arrayexpress
Project description:High diversity of testate amoebae (Amoebozoa, Arcellinida) detected by HTS analyses in a New England fen using newly-designed taxon-specific primers
| PRJNA563881 | ENA
Project description:The yeast Saccharomyces cerevisiae is a highly powerful model for systems genetics. While the advent of ordered deletion libraries has considerably facilitated yeast screening, it has also narrowed the diversity of screenable variants and precluded the exploration of the non-coding genome. Here, we present a versatile, time- and work-efficient method to functionally explore the yeast genome at an unprecedented throughput and resolution, using saturated transposon mutagenesis coupled to high-throughput sequencing. SAturated Transposon Analysis in Yeast (SATAY) allows the one-step mapping of all genetic loci in which a transposon can be inserted without disrupting a function necessary for cell growth. SATAY is especially suited to discover loci important for growth in various conditions. Here, we demonstrate that SATAY can be used to (2) reveal genetic interactions in single and multiple mutant strains, (1) reveal drug-resistant and -sensitive mutants, (3) detect not only essential genes, but also essential functional protein domains, and (4) generate not only null alleles, but also other informative genetic variants. Thus SATAY allows to easily explore the yeast genome at an unprecedented resolution and throughput.
2017-05-11 | E-MTAB-4885 | biostudies-arrayexpress
Project description:Immunoglobulin G (IgG) proteins are known for the huge diversity of the variable domains of their heavy and light chains, aimed at protecting each individual against foreign antigens. The IgG also harbor specific polymorphism concentrated in the CH2 and CH3-CHS constant regions located on the Fc fragment of their heavy chains. But this individual particularity relies only on a few amino acids among which some could make accurate sequence determination a challenge for mass spectrometry-based techniques. The purpose of the study was to bring a molecular validation of proteomic results by the sequencing of encoding DNA fragments. It was performed using ten individual samples (DNA and sera) selected on the basis of their Gm (gamma marker) allotype polymorphism in order to cover the main immunoglobulin heavy gamma (IGHG) gene diversity. Gm allotypes, reflecting part of this diversity, were determined by a serological method. On its side, the IGH locus comprises four functional IGHG genes totalizing 34 alleles and encoding the four IgG subclasses. The genomic study focused on the nucleotide polymorphism of the CH2 and CH3-CHS exons and of the intron. Despite strong sequence identity, four pairs of specific gene amplification primers could be designed. Additional primers were identified to perform the subsequent sequencing. The nucleotide sequences obtained were first assigned to a specific IGHG gene, and then IGHG alleles were deduced using a home-made decision tree reading of the nucleotide sequences. IGHG amino acid (AA) alleles were determined by mass spectrometry. Identical results were found at 95% between alleles identified by proteomics and those deduced from genomics. These results validate the proteomic approach which could be used for diagnostic purposes, namely for a mother-and-child differential IGHG detection in a context of suspicion of congenital infection.
2017-03-13 | PXD005021 | Pride
Project description:Interventions: Case vs control:No
Primary outcome(s): High-throughput sequencing
Study Design: Case-Control study
| 2676067 | ecrin-mdr-crc
Project description:To explore the PRC2-associated RNA in Arabidopsis on a genome-wide scale, we designed a high-throughput sequencing followed by PRC2 RNA-IP. We used the transgenic plants to purify the Myc-tagged CLF protein, the homologs of EZH2 (the methyltransferase of PRC2 complex) in mammal.
2020-03-07 | GSE128026 | GEO
Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.
2021-04-22 | GSE172487 | GEO