Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide mRNA expression array to identify dysregulated genes between CD26+ and CD26- HT29 cells

ABSTRACT: Genome-wide mRNA expression array to identify dysregulated genes between CD26+ and CD26- HT29 cells

PROVIDER: PRJNA793779 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

Genome-wide mRNA expression array to identify dysregulated genes between CD26+ and CD26- HT29 cells

Project description:Affymetrix HG-U133 Plus2 Array was applied to identify differentially expressed genes between FACS sorted CD26+ and CD26- subpopulations of HT29 colorectal cancer cell-line.

2022-01-14 | GSE192909 | GEO

Expression data from shROR HT29 and AGS cell

2015-06-05 | GSE67416 | GEO

Transcriptome analysis of novel CPT-CEF-treated HT29 colon cancer cells to evaluate drug cytotoxicity

Project description:Purpose: To identify differentially expressed genes in HT29 colon cancer cells after treatment with a novel formulation of camptothecin with β-cyclodextrin-EDTA-Fe3O4 nanoparticle-conjugated nanocarriers (CPT-CEF) Methods:Treated HT29 cell lines with CPT-CEF, isolated total RNA from HT29 colon cancer cells, and prepared library for RNA sequencing. Carried out comparative transcriptomic studies between treated and untreated cells to find out which gene functions were dysregulated by CPT-CEF. Results: The study yielded 247 DEGs ((FDR<0.05, FC>2.0) that were affected by CPT-CEF treatment in the HT29 colon cancer cells. The results obtained from cell cycle analysis, mitochondrial depolarization assay and acridium orange/propidium iodide double staining showed potential of CPT-CEF in cancer cell inhibition. Conclusion: Our study successfully identified DEGs in the CPT-CEF treated HT29 colon cancer cells that pointed to inhibition of cancer progression. To further affirm, animal studies are needed.

2021-09-15 | GSE165875 | GEO

Expression data from shROR HT29 and AGS cell

Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion. HT29,HT29-shROR, HT29-Mock, AGS, AGS-shROR, AGS-Mock cells were selected for RNA extraction and hybridization on Affymetrix microarrays.

2015-06-05 | E-GEOD-67416 | biostudies-arrayexpress

Identify the dysregulated miRNA in human colorectal cancer tissues

Project description:Dysregulated miRNA in human colorectal cancer (CRC) were identified through comparison between 4 CRC tumors and their adjacent normal tissues by miRNA array. Histologically-confirmed CRC were included in this study. CRC tissues and paired adjacent normal tissues were obtained from the resected surgical specimens. The adjacent normal tissue is composed of normal colonic mucosa located at approximately 10 cm away from the cancer tissue. miRNA profiling of 754 human miRNAs was performed using TaqMan Human MiRNA Array Set v3.0. Quantitative real-time polymerase chain reaction (Q-PCR) was performed using Applied Biosystems 7900HT Real-Time PCR System (Applied Biosystems). Results were analyzed by the SDS RQ Manager 1.2 software (Applied Biosystems).

2013-03-20 | GSE45349 | GEO

miRNA profiling of EV71 infected HT29 cells

Project description:HT29 cells was infected with EV71 at MOI 1 or nil respectively and harvested at 36hpi We use miRNA microarray to profile and identify miRNA which are up or down regulated due to EV71 infection

2014-05-08 | GSE57372 | GEO

Differential Gene expression of furin knockout (KO) DLD1, HCA7 and HT29 colorectal cancer cells

Project description:We created furin KO cells in three colorectal cancer cell lines (DLD1, HCA7 and HT29) using CRISPR-Cas9 genome editing. And then we performed RNA-Seq analysis in furin KO colorectal cancer cells to identify potential effect of furin on gene expression patterns in DLD1, HCA7 and HT29 cells.

2020-03-15 | GSE130969 | GEO

Identify the dysregulated miRNA in human colorectal cancer tissues

2013-03-20 | E-GEOD-45349 | biostudies-arrayexpress

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO