Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

High-throughput sequencing and morphology perform equally well for benthic monitoring of marine ecosystems (18S V4 RNA/DNA MiSeq)

ABSTRACT: High-throughput 18S V4 ribosomal DNA and RNA sequences could be used to calculate biotic indices for monitoring the impact of two Scotland salmon fish farms on Metazoa communities. The few species that could be assigned and incorporated in AMBI and ITI indices formulas yielded comparable results than with calculations based in morphological data. For both DNA and RNA extractions performed on 45 sediment samples and cDNA synthesis for RNA, we PCR amplified the 37f hypervariable region of the foramnifera using tagged PCR primers prior to library preparation (TruSeq) and MiSeq paired-end sequencing. The combinations of tagged primers are contained in the paried reads and could be used to assign the sequences the their sample of origin.

PROVIDER: PRJEB23558 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR2300330_1.fastq.gz	Fastqsanger.gz
	ERR2300330_2.fastq.gz	Fastqsanger.gz
	ERR2300340_1.fastq.gz	Fastqsanger.gz
	ERR2300340_2.fastq.gz	Fastqsanger.gz
	ERR2300350_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 200

Similar Datasets

primer_index_bias

Project description:Sequences produced using indexed (tagged, barcoded) primers in single and double PCR.

| PRJEB12717 | ENA

mRNA sequencing of PPD3 over expression in Col-0 background in Arabidopsis

Project description:The PPD3 genomic DNA was cloned in the binary vector pCAMBIA1302C with its native promoter of about 1.5 kb and was tagged with GFP. Wild type Col-0 plants were transformed by the dipping method and screened for positive plants by hygromycin and also by PCR primers for presence of the transgene.

2019-05-08 | GSE114194 | GEO

Nassar2022 - Microbiome PCR primer NER model

Project description:Microbiome PCR primer model is a Named Entity Recognition (NER) model that identifies and annotates microbiome target gene primers in texts. This is the final model version used to annotate metagenomics publications in Europe PMC and enrich metagenomics studies in MGnify with primer metadata from literature. For more information, please refer to the following blogs: http://blog.europepmc.org/2020/11/europe-pmc-publications-metagenomics-annotations.html https://www.ebi.ac.uk/about/news/service-news/enriched-metadata-fields-mgnify-based-text-mining-associated-publications

2022-02-21 | MODEL2202170011 | BioModels

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

2022-12-01 | GSE121363 | GEO

The Role of Satb1 in Shaping the Repertoire of T Cell Receptor Genes

Project description:To explore the role of Satb1 in rearrangement and repertoire of TCR genes, we used Satb1contional knockout micwhich the Satb1 gene was deleted in long term hematopoietic stem cells. We applied 5ʹRACE (rapid amplification of cDNA ends) PCR technique to generate deep sequencing libraries of Tcrd, Tcrg, Tcrb, and Tcra cDNA by using a single set of primers for each TCR gene. We obtained millions of TCR sequences and unraveled the complexity of T-cell diversity. Our experimental evidence demonstrates that Satb1 has substantial influences on the TCR repertoire.

2020-07-10 | GSE154069 | GEO

Project description:Evaluation of comammox amoA subunit (q)PCR primers

| PRJNA977628 | ENA

4C-seq experiment on mouse skeletal muscle and DP thymocytes

Project description:Purpose: The aim of this study is to investigate enhancer promoter interactions in skeletal muscle Methods: 50 ng of purified DNA were used as a template for PCR with bait-specific primers (Table S5) containing Illumina adapter termini. PCR reactions were pooled and, after primer removal with 1.8x AMPure XP beads, DNA was sequenced with the HiSeq 4000 (Illumina), as single-end 50 bp reads. Sequences were trimmed to remove primer and bait fragment sequence with the sabre tool (https://github.com/najoshi/sabre), mapped to the genome with Bowtie and converted to restriction fragment space as in van de Werken et al., 2012 (van de Werken et al., 2012). Interactions were called on single 4C experiments with peakC (Geeven et al., 2018), using a sliding window of 21 fragments.

2020-10-01 | GSE142516 | GEO

Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells

Project description:We infected ZNF417 ZNF587 dKO 293T or control 293T with NL4.3 virus for 48 hours. Then genomic DNA was purified from cell lysis with by phenol chloroform. DNA was sheared into 300 bp-500 bp random fragments using Covaris Adaptive Focused Acoustics (Covaris, Woburn, MA). Sheared DNA was ligated with a linker and PCR with primers targeting HIV LTR and linker. PCR products were performed second PCR with Illumina adaptor primers. Libraries were so constructed and sequenced on Novaseq 6000.

2021-12-31 | GSE174239 | GEO

MULTI-seq: Universal sample multiplexing for single-cell RNA sequencing using lipid-tagged indices

Project description:MULTI-seq: Universal sample multiplexing for single-cell RNA sequencing using lipid-tagged indices

| PRJNA531855 | ENA

Dual Barcode is Essential for the Specificity of DSB Repair Capture

Project description:We discovered that PCR-mediated template switching poses a significant challenge in ensemble tagged PCR, particularly in the template sequences with high similarities, which we successfully addressed by introducing a dual barcode. Template switching presents in repair sequencing (repair seq) and severely interfere the interpretation of the association between repair outcomes and the sgRNA in the vicinity. Among the 67 DNA damage response genes, we found that ERCC6L2 was crucial for preventing the DNA end resection.

2024-04-01 | GSE253191 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data