Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq of rs2280381-containing region knock out clone in U937

ABSTRACT: RNA-seq of rs2280381-containing region knock out clone in U937

PROVIDER: PRJEB43182 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR5324100_1.fastq.gz	Fastqsanger.gz
	ERR5324100_2.fastq.gz	Fastqsanger.gz
	ERR5324101_1.fastq.gz	Fastqsanger.gz
	ERR5324101_2.fastq.gz	Fastqsanger.gz
	ERR5324102_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

RNA-seq of rs2280381-containing region knock out clone in U937

Project description:rs2280381 is an autoimmune disease susceptible loci, which have be reported to be associated with SLE, RA and SSc.Genetic and epigenomic analysis indicate that rs2280381-containing region is an enhancer region in monocyte. To test the function and regulated genes of rs228381-containing region, we deleted rs2280381 ~120bp sequence in U-937 cells, and performed the RNA-seq to detect the gene expression profiles.

2021-07-01 | E-MTAB-10126 | biostudies-arrayexpress

RNA-seq data of rs2280381-containing region knock out clone in U-937 cell line

Project description:RNA-seq data of rs2280381-containing region knock out clone in U-937 cell line

| PRJEB50025 | ENA

RNA-seq data of rs2280381-containing region knock out clone in U-937 cell line

Project description:rs2280381 is an autoimmune disease susceptible variant, which has been reported to be associated with SLE, RA and SSc. Genetic and epigenomic analysis indicate that the rs2280381-containing region is an enhancer region in monocyte. To test the function and regulated genes of the rs228381-containing region, we deleted the rs2280381 ~120bp sequence in U-937 cells, and performed the RNA-seq to detect the gene expression profiles.

2022-02-25 | E-MTAB-11306 | biostudies-arrayexpress

Genes regulated after knock-down of Pirin in U937 cells

Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.

2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress

4C-Seq identify the interaction between IRF8 promoter and rs2280381-containing region

Project description:To test if there is a physical interaction between the IRF8 promoter and the rs2280381-containing region, we conducted circular chromatin conformation capture assay in the U937 cell. For the IRF8 viewpoint group, we used CSP6I as the first digested enzyme and NlaIII as the second enzyme. For the rs2280381-containing region, we used MboI as the first digested enzyme and NlaIII as the second enzyme. We use 4C-PCR primer to construct IRF8 point view and rs2280381-containing region 4C library.

2021-07-01 | E-MTAB-10120 | biostudies-arrayexpress

U937 ctrl vs U937 Saha (Vorinostat; suberoylanilide hydroxamic acid) 6h

Project description:miRNA expression profiling of U937 ctrl vs U937 treated Saha 5 µM 6h

2017-05-22 | GSE69957 | GEO

Real-time quantitative PCR analysis of differentiated U937 cells stimulated with LPS+IFNgamma

Project description:U937 monocyte cell line was differentiated using PMA. Differentiated U937 monocytes were exposed to MEM+10% FBS medium (untreated cells) and the same medium containing LPS+IFNgamma. The changes in the gene expression of cytokines and chemokines were evaluated using RT2 Profiler qPCR array

2024-08-23 | GSE275490 | GEO

U937 scramble (Usc) vs U937 miR-194-5p (UmiR-194-5p)

Project description:Transcriptional profiling of U937 scramble vs U937 miR-194-5p (UmiR-194-5p)

2017-05-22 | GSE73646 | GEO

Genes regulated after knock-down of Pirin in U937 cells

2009-12-10 | GSE16798 | GEO