Fecal eucaryotes in Parkinson's disease
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB45549 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR6018020_1.fastq.gz | Fastqsanger.gz | |||
| ERR6018020_2.fastq.gz | Fastqsanger.gz | |||
| ERR6018030_1.fastq.gz | Fastqsanger.gz | |||
| ERR6018030_2.fastq.gz | Fastqsanger.gz | |||
| ERR6018040_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 72 |
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Importance. Biological markers of Parkinson’s disease are essential for achieving disease modification. Objective. To determine the association of SNCA blood transcript levels with prevalence of Parkinson’s disease. Background. The SNCA locus is preferentially transcribed in neurons and blood cells. Non-coding genetic variants and neuronal aggregates of α-synuclein protein associate this locus with sporadic Parkinson’s disease and suggest a potential role for abnormal SNCA transcription in the disease mechanism. Here we investigated variation in intracellular SNCA gene expression and SNCA transcript isoform abundance in circulating blood cells of cases with PD and controls in a network of biobanks that represent regional, national, and international populations. Design, Setting, Participants. Three cross-sectional, case-control studies nested in observational biomarker studies. 222 cases with early-stage clinical PD and 183 controls were enrolled from 2005 to 2010 in the Harvard Biomarker Study (HBS) at two Harvard-affiliated tertiary care centers. 76 cases with dopamine transporter imaging (DAT)-confirmed PD and 42 controls were enrolled between August 2007 and December 2008 in the Blood α-Synuclein, Gene Expression and Smell Testing as Diagnostic and Prognostic Biomarkers in Parkinson’s Disease Study (PROBE) study from 22 US tertiary care centers. 202 DAT-confirmed cases with de novo PD and 138 controls were enrolled in the Parkinson’s Progression Markers Initiative (PPMI) between July 2010 and November 2012 from 22 US and international tertiary care centers. Main Outcome Measures. Association of intracellular SNCA transcript abundance with PD estimated on analog and digital expression platforms. Results. Reduced levels of SNCA transcripts were associated with early-stage clinical PD, neuroimaging-confirmed PD, and untreated, neuroimaging-confirmed PD in accessible, peripheral blood cells from a total of 863 individuals. SNCA expression was reduced by 17%, 22%, and 16% in cases compared to controls in the HBS, PROBE, and PPMI study with P values of 0.004, 0.025, and 0.018, respectively, after adjusting for clinical, hematological, and processing covariates. Specific SNCA transcripts with long 3’ untranslated regions (UTR) and those skipping exon 5 are implicated in the accumulation and mitochondrial targeting of α-synuclein protein in Parkinson’s pathology. These transcript isoforms were linked to PD through digital expression analysis. Individuals in the lowest quartile of SNCA expression values had covariate-adjusted odds ratios for PD of 2.14 (95% C. I. 1.1-4.1), 4.5 (95% C. I. 1.3-15), and 2.1 (1.1-4.0) compared to individuals in the highest quartile of expression values in the HBS, PROBE, and PPMI study, respectively. Conclusions and Relevance. Reduced levels of SNCA expression, particularly of disease-relevant transcripts with extended 3’ UTR or exon 5 skipping, are associated with early-stage PD. These findings support a potential role for SNCA as a transcriptional marker of PD and may have implications for patient stratification and risk assessment.
2015-06-01 | GSE57475 | GEO
Project description:Parkinson’s disease is second most prevalent neurodegenerative disorder. Parkinson’s disease is hypothesized to be caused by a multifaceted interplay between genetic and environmental factors. We profiled the DNA methylation using the frontal lobe from people who died from Parkinson’s disease and compared them with age-, and sex-matched controls. We hypothesized that the complex regulation of DNA methylation and metabolome leads to deficits that cause irregular motor function among Parkinson’s disease subjects and the metabolomic disparities may reflect the effect of these complex interactions. Herein, we aim to integrate quantitative metabolomics and DNA methylation of brain tissue from primary motor cortex (Brodmann area 4) from Parkinson’s disease sufferers to better understand the biochemistry associated with the onset of the disease. Parkinson’s disease (PD) is second most prevalent neurodegenerative disorder following Alzheimer’s disease. Parkinson’s disease is hypothesized to be caused by a multifaceted interplay between genetic and environmental factors. Herein, and for the first time, we describe the integration of metabolomics and epigenetics (genome-wide DNA methylation; epimetabolomics) to profile the frontal lobe from people who died from PD and compared them with age-, and sex-matched controls. We identified 48 metabolites to be at significantly different concentrations (FDR q<0.05), 4,313 differentially methylated sites [5'-C-phosphate-G-3' (CpGs)] (FDR q<0.05) and increased DNA methylation age in the primary motor cortex of people who died from PD. We identified Primary bile acid biosynthesis as the major biochemical pathway to be perturbed in the frontal lobe of PD sufferers, and the metabolite taurine (p-value = 5.91E-06) as being positively correlated with CpG cg14286187 (SLC25A27; CYP39A1) (FDR q = 0.002), highlighting previously unreported biochemical changes associated with PD pathogenesis. In this novel multi-omics study, we identify regulatory mechanisms which we believe warrant future translational investigation and central biomarkers of PD which require further validation in more accessible biomatrices.
2022-04-20 | GSE195834 | GEO
Project description:Establishing reliable biomarkers for assessing and validating clinical diagnosis at early prodromal stages of Parkinson’s disease is crucial for developing therapies to slow or halt disease progression. Here, we present the largest study to date using whole blood gene expression profiling from over 500 individuals to identify an 87-gene blood-based signature. Our gene signature effectively differentiates between idiopathic PD patients and controls in both a validation cohort and an independent test cohort, and further highlights mitochondrial metabolism and ubiquitination/proteasomal degradation as potential pathways disrupted in Parkinson’s disease.
2017-05-20 | GSE99039 | GEO
Project description:Alterations of the Fecal Microbiome in Parkinson's Disease
| PRJEB4927 | ENA
Project description:Genome-wide association studies (GWAS) have uncovered thousands of single nucleotide polymorphisms (SNPs) that are associated with Parkinson's disease (PD) risk. The functions of most of these SNPs, including the cell type they influence, and how they affect PD etiology remain largely unknown. To identify functional SNPs, we aligned PD risk SNPs within active regulatory regions of DNA in microglia, a cell type implicated in PD development. Out of 6,749 ‘SNPs of interest’ from the most recent PD GWAS metanalysis, 73 were located in open regulatory chromatin as determined by both ATAC-seq and H3K27ac ChIP-seq. We identified an active enhancer in microglia in intron two of SNCA that overlaps two PD risk SNPs, rs2737004 and rs2619356. In iPSC-derived microglia, CRISPR/Cas9 deletion of the open chromatin encompassing these SNPs caused reduced expression of multiple genes including SNCA and the adjacent gene MMRN1. Loss of the enhancer also led to upregulation of genes involved in glucose metabolism, a process that is known to be altered in PD patients. Our work expands the role of SNCA in Parkinson’s Disease and provides a connection between PD-associated genetic variants and underlying biology that points to a risk mechanism in microglia.
2024-01-21 | GSE245522 | GEO
Project description:Genome-wide association studies (GWAS) have uncovered thousands of single nucleotide polymorphisms (SNPs) that are associated with Parkinson's disease (PD) risk. The functions of most of these SNPs, including the cell type they influence, and how they affect PD etiology remain largely unknown. To identify functional SNPs, we aligned PD risk SNPs within active regulatory regions of DNA in microglia, a cell type implicated in PD development. Out of 6,749 ‘SNPs of interest’ from the most recent PD GWAS metanalysis, 73 were located in open regulatory chromatin as determined by both ATAC-seq and H3K27ac ChIP-seq. We identified an active enhancer in microglia in intron two of SNCA that overlaps two PD risk SNPs, rs2737004 and rs2619356. In iPSC-derived microglia, CRISPR/Cas9 deletion of the open chromatin encompassing these SNPs caused reduced expression of multiple genes including SNCA and the adjacent gene MMRN1. Loss of the enhancer also led to upregulation of genes involved in glucose metabolism, a process that is known to be altered in PD patients. Our work expands the role of SNCA in Parkinson’s Disease and provides a connection between PD-associated genetic variants and underlying biology that points to a risk mechanism in microglia.
2024-01-21 | GSE245523 | GEO
Project description:Parkinson’s Disease is a multi-system, disabling progressive neurodegenerative condition. Clinical progression is highly heterogeneous and, thus far, there are not available biomarkers to accurately predict the rate of disease progression. Thus, identifying molecular signatures that allow discriminating between different progression rates might significantly assist the therapeutic strategy, and enable improved outcomes in clinical trials. We performed an exploratory cross-sectional study aimed at determining whether gene expression differences in peripheral blood may be used to discriminate between patients with slow or rapid Parkinson’s disease progression
2016-04-25 | GSE80599 | GEO