Ultrahigh-throughput discovery of modified aptamers as specific and potent enzyme inhibitors
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB79572 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR13617642.fastq.gz | Fastqsanger.gz | |||
| ERR13617643.fastq.gz | Fastqsanger.gz | |||
| ERR13617644.fastq.gz | Fastqsanger.gz | |||
| ERR13617645.fastq.gz | Fastqsanger.gz | |||
| ERR13617646.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 25 |
Similar Datasets
Project description:Enzymes are instrumental to life and key actors of pathologies, making them relevant drug targets. Most enzyme inhibitors consist of small molecules. Although efficient, their development is long, costly and can come with unwanted off-targeting. Substantial gain in specificity and discovery efficiency is possible using biologicals. Best exemplified by antibodies, these drugs derived from living systems display high specificity and their development is eased by harnessing natural evolution. Aptamers are nucleic acids sharing functional similarities with antibodies while being deprived of many of their limitations. Yet, the success rate of inhibitory aptamer discovery remained hampered by the lack of an efficient discovery pipeline. In this work, we addressed this issue by introducing an ultrahigh-throughput strategy combining in vitro selection, microfluidic screening and bioinformatics. We demonstrate its efficiency by discovering a modified aptamer that specifically and strongly inhibits SPM-1, a beta-lactamase that remained recalcitrant to the development of potent inhibitors.
2024-09-15 | E-MTAB-14407 | biostudies-arrayexpress
Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.
2022-02-28 | PXD002480 | Pride
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:There is an urgent need for agents that promote health and regeneration of cells and tissues, specifically to treat diseases of the aging nervous system. Age-associated nervous system degeneration and various diseases are driven by many different biochemical stresses, often making it difficult to target any one disease cause. Our laboratory has previously identified DNA aptamers with apparent regenerative properties in murine models of multiple sclerosis by selecting aptamers that bind oligodendrocyte membrane preparations. Here, we selected from vast libraries of molecules (~1014 unique DNAs) those with the ability to bind cultured human SH-SY5Y neuroblastoma cells as a neuronal model, followed by screening for aptamers capable of eliciting biological responses, with validation of binding in differentiated SH-SY5Y, human iPSC-derived sensory neurons, and hESC derived cortical neurons. This demonstrates a proof-of-concept workflow to identify biologically active aptamers by cycles of cell selection.
2024-11-11 | GSE278187 | GEO
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
2019-12-31 | GSE137006 | GEO
Project description:RNAs are well-suited to act as cellular sensors that detect and respond to metabolite changes in the environment due to their ability to fold into complex structures. Here, we introduce a genome-wide strategy called PARCEL that experimentally identifies RNA aptamers in vitro, in a high-throughput manner. By applying PARCEL to a collection of prokaryotic and eukaryotic organisms, we have revealed 58 new RNA aptamers to three key metabolites, greatly expanding the list of natural RNA aptamers. The newly identified RNA aptamers exhibit significant sequence conservation, are highly structured and show an unexpected prevalence in coding regions. We identified a prokaryotic precursor tmRNA that acts as a vitamin B2 (FMN) binder to facilitate its maturation, as well as new coding-region eukaryotic riboswitches that bind and respond to FMN, highlighting FMN as a second class of eukaryotic riboswitches. PARCEL results show that RNA-based sensing and gene regulation is more widespread than previously appreciated in different organisms.
2018-03-06 | GSE106133 | GEO
Project description:Aptamers against Anaplasma phagocytophilum and its host cells
| PRJEB62495 | ENA
Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics. To evaluate the influence of synthetic ssDNA oligonucleotides (SB_ODN, CpG_ODN) on the cells of circulating peripheral blood (n=3), the samples were divided into 7 groups, 0h_without ssDNA, 2h_without ssDNA, 2h_with SB_ODN, 2h_with CpG_ODN, 4h_without ssDNA, 4h_with SB_ODN, 4h_with CpG_ODN. Baseline value samples (0h_without ssDNA) were obtained after blood collection without rotating in the closed-loop model. Negative control samples (2h_without ssDNA and 4h_without ssDNA) did not include oligonucleotides but rotated in the closed-loop model.
2013-05-07 | E-GEOD-46676 | biostudies-arrayexpress
Project description:Discovery of pan-Histone Acetyltransferase Inhibitors with Potent Antitumor Activity in vivo
| PRJNA412905 | ENA
Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics.
2013-05-07 | GSE46676 | GEO