Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1013173 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR25928096_1.fastq.gz | Fastqsanger.gz | |||
| SRR25928096_2.fastq.gz | Fastqsanger.gz | |||
| SRR25928097_1.fastq.gz | Fastqsanger.gz | |||
| SRR25928097_2.fastq.gz | Fastqsanger.gz | |||
| SRR25928098_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 6 |
Similar Datasets
Project description:Identify aptamers binding human PD-L1 protein by SELEX
| PRJEB65891 | ENA
Project description:The ability to detect and target β cells in vivo can drastically refine the way diabetes is studied and treated. By an unsupervised Systematic evolution of ligands by exponential enrichment (SELEX) we identified two RNA aptamers that specifically recognize mouse and human β cells in vitro and in vivo. Here we took advantage of commercially available high density protein arrays to identify putative target of the two islet specific aptamers. Briefly, 5' biotynilated RNA aptamer 1-717 and m12-3773 were chemically produced , complexed with Alexafluor 647-streptavidin and used as probe on the HuProt™ v2.0 19K protein array. Putative binders were further confirmed by cold target inhibition assays, silencing experiments, and surface plasmon resonance.
2022-02-21 | GSE162273 | GEO
Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.
2024-02-01 | GSE254651 | GEO
Project description:Identify the binding proteins of PD-L1 to clarify the physiological functions of PD-L1.
2020-08-28 | PXD015191 | JPOST Repository
Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.
2022-02-23 | GSE197262 | GEO
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress
Project description:Tumors expressing high level of programmed cell death-1 (PD-1) ligand 1 (PD-L1) are more likely to respond to immune checkpoint blockers (ICBs) targeting PD-1 or PD-L1. However, more than half of tumor patients with high PD-L1 expression does not respond to ICBs and the underlying mechanisms are yet to be clarified. Here we show that depletion of developmentally regulated GTP-binding protein 2 (DRG2) inhibited recycling of endosomal PD-L1 and reduced surface PD-L1 level in melanoma cells. DRG2-depleted cells showed decreased binding with recombinant PD-1. Although DRG2-depleted cells expressed high levels of PD-L1, anti-PD-1 ICB did not activate T cells within DRG2-depleted tumors and failed to improve the survival of DRG2-depleted tumor-bearing mice. Cohort analysis of melanoma patients under anti-PD-1 treatment revealed that patients bearing tumors with high DRG2 protein level were more sensitive to PD-1 anti-PD-1 ICBs. These findings identify DRG2 as a regulator of recycling of endosomal PD-L1 and a key determinant for response to anti-PD-1 ICB and provide insights into how to increase the correlation between PD-L1 expression and response to ICB.
2023-11-06 | GSE231973 | GEO
Project description:Tumors expressing high level of programmed cell death-1 (PD-1) ligand 1 (PD-L1) are more likely to respond to immune checkpoint blockers (ICBs) targeting PD-1 or PD-L1. However, more than half of tumor patients with high PD-L1 expression does not respond to ICBs and the underlying mechanisms are yet to be clarified. Here we show that depletion of developmentally regulated GTP-binding protein 2 (DRG2) inhibited recycling of endosomal PD-L1 and reduced surface PD-L1 level in melanoma cells. DRG2-depleted cells showed decreased binding with recombinant PD-1. Although DRG2-depleted cells expressed high levels of PD-L1, anti-PD-1 ICB did not activate T cells within DRG2-depleted tumors and failed to improve the survival of DRG2-depleted tumor-bearing mice. Cohort analysis of melanoma patients under anti-PD-1 treatment revealed that patients bearing tumors with high DRG2 protein level were more sensitive to PD-1 anti-PD-1 ICBs. These findings identify DRG2 as a regulator of recycling of endosomal PD-L1 and a key determinant for response to anti-PD-1 ICB and provide insights into how to increase the correlation between PD-L1 expression and response to ICB.
2023-11-06 | GSE231972 | GEO
Project description:Disrupting PD-1/PD-L1 interaction rejuvenates antitumor immunity. Clinical successes by blocking PD-1/PD-L1 binding have grown across wide-ranging cancer histologies, but innate therapy resistance is evident in the majority of treated patients1. Cancer cells can express robust surface levels of PD-L1 to tolerize tumor-specific T cells, but regulation of PD-L1 protein levels in the cancer cell is poorly understood. Quasi-mesenchymal tumor cells up-regulate PD-L1/L2 and induce an immune-suppressive microenvironment, including expansion of M2-like macrophages and regulatory T cells and exclusion of CD8+ T-cell infiltration2. Targeted therapy, including MAPK inhibitor therapy in melanoma, leads to quasi-mesenchymal transitions and resistance3, and both MAPK inhibitor treatment and mesenchymal signatures are associated with innate anti-PD-1 resistance4,5. Here we identify ITCH as an E3 ligase that downregulates tumor cell-surface PD-L1/L2 in PD-L1/L2-high cancer cells, including MAPK inhibitor-resistant melanoma, and suppresses acquired MAPK inhibitor resistance in and only in immune-competent mice. ITCH interacts with and poly-ubiquitinates PD-L1/L2, and ITCH deficiency increases cell-surface PD-L1/L2 expression and reduces T cell activation. Mouse melanoma tumors grow faster with Itch knockdown only in syngeneic hosts but not in immune-deficient mice. MAPK inhibitor therapy induces tumor cell-surface PD-L1 expression in murine melanoma, recapitulating the responses of clinical melanoma3, and this induction is more robust with Itch knockdown. Notably, suppression of ITCH expression first elicits a shift toward an immune-suppressive microenvironment and then accelerates resistance development. These findings collectively identify ITCH as a critical negative regulator of PD-L1 tumor cell-surface expression and provide insights into previously unexplained role of PD-L1 in adaptive resistance to therapy.
2022-03-31 | MSV000089180 | MassIVE