Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S V3-V4 amplicon sequencing of infected Medicago truncatula root tissues

PROVIDER: PRJNA1077341 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR27990700_1.fastq.gz	Fastqsanger.gz
	SRR27990700_2.fastq.gz	Fastqsanger.gz
	SRR27990701_1.fastq.gz	Fastqsanger.gz
	SRR27990701_2.fastq.gz	Fastqsanger.gz
	SRR27990702_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 108

Similar Datasets

Cell- and tissue-specific transcriptome analyses of Medicago truncatula root nodules

Project description:We used laser-capture microdissection (LCM) to isolate specific cells from the Medicago truncatula nodule meristem (M), the distal infection (DIZ), the proximal infection zone (PIZ), infected cells (IC) and uninfected cells (UIC) from the fixation zone. Based on Medicago GeneChips, we identified the cell- and tissue-specific programm of gene expression in Medicago truncatula root nodules.

2013-05-29 | GSE43354 | GEO

food fermentation metagenome

Project description:16S V3-V4 amplicon sequencing

| PRJDB9082 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula

Project description:To identify key miRNAs involved in root meristem formation in M. truncatula, deep sequencing was used to compare the miRNA populations dreived from four tissues. These were; root tip tissue, containing the root apical meristem, elongation zone tissue, root forming callus tissue and non-root forming callus tissue. We identified 83 previously reported miRNAs, 24 new to M. truncatula, in 44 families. For the first time in M. truncatula, members of conserved miRNA families mir165, miR181 and miR397 were found. Bioinformatic analysis identified 38 potential novel miRNAs. Many miRNAs were differentially expressed between tissues, particularly RFC and NRFC. Examination and comparison of the microRNA population of four Medicago truncatula tissue types

2013-04-03 | E-GEOD-45726 | biostudies-arrayexpress

7a75f7bd-831c-4b1a-9a69-e36963fb9e78 - samples

Project description:Amplicon sequencing from 45 samples - Amplicons of 16s v3-v4

| EGAD00001005027 | EGA

High-throughput pyrosequencing of miRNAs from Medicago truncatula nodules and roots

Project description:We have used deep sequencing of small RNAs from nodules and root apexes of the model legume Medicago truncatula, to identify 113 novel candidate miRNAs. These miRNAs (legume or Mt-specific) are encoded by 278 putative hairpin precursors in the M. truncatula genome. Several miRNAs are differentially expressed in nodules and root tips and large variety of targets could be predicted for these genes. Specific miRNA isoforms showed contrasting expression patterns in these tissues Keywords: Transcriptome analysis

2009-07-07 | GSE15438 | GEO

First exploration of the altered microbial gut-lung axis in the pathogenesis of human refractory chronic cough

Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.

2024-04-17 | GSE240646 | GEO

Longitudinal and Diurnal Experiments of M. hapla and M. truncatula

Project description:We have infected the model legume Medicago truncatula with Meloidogyne hapla and harvested tissue over a time course. Transcriptome sequencing was performed on each sample using the Illumina RNA-Seq method. [Longitudinal Experiment] RNA was isolated from M. hapla eggs and pre-penetration juveniles (J2) and also from a time course of M. truncatula infected with M. hapla J2 at five time points: 1, 2, 4, 5, and 7 days after inoculation (DAI). Roots (local) and shoots (global) tissues from infected and uninfected plants were sampled. Each sample was loaded on five lanes for sequencing. Collectively, 22 samples were generated in total from - M. hapla egg and J2 (two samples), - infected M. truncatula root 1-2-4-5-7 DAI (five samples), - infected M. truncatula shoot 1-2-4-5-7 DAI (five samples), - uninfected M. truncatula root 1-2-4-5-7 DAI (five samples), - and uninfected M. truncatula shoot 1-2-4-5-7 DAI (five samples). Thus, 110 fastq files (= 22 samples x 5 lanes). [Diunrnal Experiment] M. truncatula roots inoculated with M. hapla was sampled at 6 time-points: 22:30, 2:00, 5:00, 6:30, 14:00, and 21:00. Lighting was turned off at 22:00 and turned on at 06:00. Four biological replicates were taken for each time point, providing 24 samples in total. Thus, 24 fastq files (= 6 time points x 4 replicates).

2017-04-30 | E-MTAB-4724 | biostudies-arrayexpress

Transcriptom analysis of the interaction Medicago truncatula – Ralstonia solanacearum

Project description:affy_ralstonia_medicago - Ralstonia solanacearum is the causal agent of the devastating bacterial wilt disease. Its infection process was studied with an in vitro inoculation procedure on intact roots of Medicago truncatula. The pathosystem involved susceptible A17 and resistant F83005.5 M truncatula lines infected with the pathogenic strain GMI1000. The mutant A17 line, Sickle, which showed a resistant phenotype was also part of the experiment. To identify host signaling pathway triggered by R. solanacearum infection with a focus on the involvment of ethylene, we used the Medicago Affymetrix array to monitore the expression profiles and the molecular process associated with initial symptoms development (12hpi) and colonization (72hpi). In order to maximize chances to observe differential gene expression, RNA samples were extracted from the root infection zone (root tips) -Three Medicago truncatula lines, A17, F83005.5 and sickle were inoculated with GMI1000 Ralstonai solanacearum strain (107 cfu/ml). RNA were extracted from root extremities (1 cm above the root tip) at time 0, 12h and 72h post inoculation. Three biological repeats were conducted

2011-09-10 | GSE18473 | GEO

High-throughput pyrosequencing of miRNAs from Medicago truncatula nodules and roots

2009-07-07 | E-GEOD-15438 | biostudies-arrayexpress