Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test
Project description:Anopheles gambiae mosquitoes transmit the human malaria parasite Plasmodium falciparum, which causes the majority of fatal malaria cases worldwide. The hematophagous life style defines the mosquito reproductive biology and is exploited by P. falciparum for its own sexual reproduction and transmission. The two main phases of the mosquito reproductive cycle, pre-vitellogenic (PV) and post-blood meal (PBM) shape its capacity to transmit malaria. Transition between these phases is tightly coordinated to ensure homeostasis between mosquito tissues and successful reproduction. One layer of control is provided by microRNAs, well-known regulators of blood meal digestion and egg development in mosquitoes. Here, we report a global overview of tissue-specific miRNA expression during the PV and PBM phases and identify miRNAs regulated during PV to PBM transition. The observed coordinated changes in the expression levels of a set of miRNAs in the energy-storing tissues suggest a role in the regulation of blood meal-induced metabolic changes.
Project description:The age of mosquitoes is a crucial determinant of their susceptibility to infection, probability of survival to transmit pathogens and tolerance to insecticides. We investigated changes to the abundance of proteins found in heads and thoraces of Anopheles gambiae and Anopheles stephensi as they aged. Protein expression changes were assessed using two-dimensional difference gel electrophoresis and the identity of differentially expressed proteins was determined by using either matrix-assisted laser desorption ionization tandem time-of-flight mass spectrometry or capillary high-pressure liquid chromatography coupled with a linear ion-trap (LTQ)-Orbitrap XL hybrid mass spectrometer. Protein biomarkers were validated by quantitative Western blot analysis.
Project description:Anopheline mosquitoes frequently take multiple blood meals in a single gonotrophic cycle. In this study we determined patterns of gene expression in Anopheles gambiae females blood fed twice within the first gonotrophic cycle.
Project description:Wolbachia, an endosymbiotic bacterium, is being investigated as a vector control agent in several insect species. Along with the well known classical reproductive parasitism Wolbachia employs against its host to spread within the population, it is emerging that the bacteria can protect the host against pathogens and reduced pathogen transmission. Anopheles mosquitoes, which transmit malaria, have never been found to harbour Wolbachia in nature, and despite numerous transinfection attempts, no stable line has been developed. However recently, two strains of Wolbachia, wAlbB from Aedes albopictus, and wRi from Drosophila simulans were cultured in Anopheles gambiae Sua5B cells. These cell lines provides an amenable system to study Wolbachia-Anopheles interaction in the absence of a stable transinfected line. It has been proposed that the compromised vector competence of Wolbachia infected insects is due to an up regulation of the basal immune state. We therefore completed a genome wide expression profile of Wolbachia infected Anopheles, assessing both wAlbB and wRi infected cells in parallel against uninfected Sua5B cells.
Project description:With their genome sequenced, Anopheles gambiae mosquitoes now serve as a powerful tool for basic research in comparative, evolutionary and developmental biology. The knowledge generated by these studies is expected to reveal molecular targets for novel vector control and pathogen transmission blocking strategies. Comparisons of gene-expression profiles between adult male and nonblood-fed female Anopheles gambiae mosquitoes revealed that roughly 22% of the genes showed sex-dependent regulation. Blood-fed females switch the majority of their metabolism to blood digestion and egg formation within 3 h after the meal is ingested, in detriment to other activities such as flight and response to environment stimuli. Changes in gene expression are most evident during the first, second and third days after a blood meal, when as many as 50% of all genes showed significant variation in transcript accumulation. After laying the first cluster of eggs (between 72 and 96 h after the blood meal), mosquitoes return to a nongonotrophic stage, similar but not identical to that of 3-dayold nonblood-fed females. Ageing and/or the nutritional state of mosquitoes at 15 days after a blood meal is reflected by the down-regulation of 5% of all genes. A full description of the large number of genes regulated at each analysed time point and each biochemical pathway or biological processes in which they are involved is not possible within the scope of this contribution. Therefore, we present descriptions of groups of genes displaying major differences in transcript accumulation during the adult mosquito life. However, a publicly available searchable database (Anopheles gambiae Gene Expression Database at UC Irvine) has been made available so that detailed analyses of specific groups of genes based on their descriptions, functions or levels of gene expression variation can be performed by interested investigators according to their needs. Keywords: response to bloodmeal
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin