Project description:This laboratory's focus is on the immune response to carbohydrate antigens, with an emphasis on modalities to analyze and to increase the immune response. We are also interested in carbohydrate drug targeting. The hypothesis is that these 2 variants have different cell surface carbohydrate expression, which results in different adhesion patterns, which ultimately results in different metastasis patterns. Evidence for expression differences and loss of the variants ability to metastasize to the lung could have clinical implications in the prevention of metastasis to different organs. The 4T1 mouse metastatic breast cancer cell line is known to change with passages in culture. Our data has shown changes cause the cells to metastasize to the intestine rather than to the lung. Four classes of RNA were analyzed: one each from 4T1 metastatic cell line variant #1, 4T1 variant #2, non-metastatic cell lines 4T07, and non-metastatic cell line 67NR. Classes were prepared in triplicate for a total of 12 samples. All samples were hybridized to the custom designed CFG GLYCOv2 glycogene array.
Project description:A polyclonal mouse model of breast tumor heterogeneity using model cell line 4T1 was developed previously. It was shown that 4T1 cells were composed of mixed subpopulations with specializations, including dominating the primary tumor, contributing to metastatic populations, etc. Here in a different angle, we reveal that each 4T1 cells can switch between 2 distinct states, which could be easily misclassified into 2 subpopulations, as the 2 states can be distinguished by distinct patterns of gene expression, dramatic difference of metastatic competence, stem-cell like feature or not, etc. The event for each 4T1 cell to exhibit one state or another is stochastic and the metastatic competence of clones generated from a single 4T1 cell is variable rather than stable. Further, given that metastatic competence of 4T1 cells is not stable, classification of clones based on metastatic competence is highly biased. Similarly, the classification of 4T1 clones based on gene expression profiles is also highly biased. Taken together, our data support that the exhibition of metastatic competence depends on the state of 4T1 cells and do not support the existence of subpopulations with specialization. To the best of our knowledge, no similar work has ever been reported.
Project description:Recently, cancer immunotherapy has been paid much attention because of its improved efficacy and low frequency of adverse effects. A mouse breast cancer cell line, 4T1, has been known as poorly immunogeneic and highly metastatic cell line. In this study, we have identified a sub cell line of 4T1, designated as 4T1-Sapporo (4T1-S), which could induce a strong immune response against the same line. When 4T1-S was subcutaneously injected, striking enlargement of draining lymph nodes and increase of activated T cells were observed. The strong immune responses could not be observed when 4T1-S was injected to nude mice, indicating that this phenomenon is mediated by T cell response. Identification of 4T1-S characteristics may help to improve immunotherapy against breast cancer. 4T1-A1, 4T1-A2, 4T1-S1, 4T1-S2
Project description:Increasing pre-clinical data suggest that chemotherapy may elicit pro-metastatic responses in breast cancer models. Primary tumours release extracellular vesicles (EVs) that can facilitate the seeding and growth of metastatic cancer cells in distant organs, but the effects of chemotherapy on pro-metastatic EVs are poorly understood. The goal of the project was to analyse the protein content in EVs released by the mouse breast cancer cell line 4T1 after treatment with the chemotherapeutic agent paclitaxel (PTX) or its vehicle control cremophor (CREMO).
Project description:Recently, cancer immunotherapy has been paid much attention because of its improved efficacy and low frequency of adverse effects. A mouse breast cancer cell line, 4T1, has been known as poorly immunogeneic and highly metastatic cell line. In this study, we have identified a sub cell line of 4T1, designated as 4T1-Sapporo (4T1-S), which could induce a strong immune response against the same line. When 4T1-S was subcutaneously injected, striking enlargement of draining lymph nodes and increase of activated T cells were observed. The strong immune responses could not be observed when 4T1-S was injected to nude mice, indicating that this phenomenon is mediated by T cell response. Identification of 4T1-S characteristics may help to improve immunotherapy against breast cancer.
Project description:Triple negative breast cancer has an extremely poor prognosis due to lack of available targeted treatments, especially for metastasis. Metastatic sites frequently include the lymph nodes and the lungs, and during the metastatic process, breast cancer cells must come into contact with the extracellular matrix (ECM) at every step. The ECM provides both structural support and biochemical cues, and cell-ECM interactions can lead to changes in to drug response. Here, we used fibroblast-derived ECM to perform high throughput drug screening of 4T1 breast cancer cells on metastatic organ ECM (lung) and we see that drug response differs to drug inhibition on plastic. The FDM that we are able to produce from different metastatic organs is abundant in, and contains a complex mixture of ECM proteins. We also show differences in ECM composition between the primary site and metastatic sites. Furthermore, we show that global kinase signalling of 4T1 cells on the ECM is relatively unchanged between organs, however we show large changes in signalling compared to plastic. Our study highlights the importance of context when testing drug response in vitro, showing that the consideration of the ECM is critically important.
Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
Project description:Breast cancer remains a significant global health challenge, with the highly aggressive 4T1 mouse mammary carcinoma cell line serving as a common model for studying triple-negative breast cancer (TNBC) due to its metastatic potential and resistance to therapy. Cepharanthine (CEP), a natural bisbenzylisoquinoline alkaloid, has demonstrated anti-inflammatory, immunomodulatory, and anti-cancer properties in various malignancies. However, its molecular mechanisms in 4T1 cells remain poorly understood. In this study, we treated 4T1 cells with CEP and performed RNA sequencing (RNA-seq) to elucidate transcriptomic alterations induced by this compound.
Project description:We analysed the signature of the non-immune cells from the metastatic niche and the distal lung using the breast tumour 4T1 cell line as a model of lung metastasis from breast cancer
Project description:Microaaray data for CD44v8-10-positive / CD44v8-10-negative 4T1 cancer cells (mouse breast cancer cells) We used microarrays to detail the global programming of gene expression of 4T1 cells depending on whether CD44v is present or not. 4T1 cells, one of the mouse breast cancer cells, were selected for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain the data about to which extent gene expression profile is different between CD44v-positive and CD44v-negative 4T1 cancer cells.