Transcriptomes change differently in different cancer cells upon SYK stable knockdown
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA518088 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Purpose: The goals of this study are to compare NGS-derived transcriptome profiling (RNA-seq) to find out the difference between SYK stable knockdown and negative control group in each cancer cell line, and find the transcriptomes change upon SYK knockdown. Methods: mRNA profiles of cell lines were generated using Illumina PE150, then GSEA was used for analyzing the association between SYK knockdown and the mesenchymal or epithelial signature. Results: The result showed epithelial signatures were up-regulated, while mesenchymal signatures were down-regulated upon SYK knockdown in RNA-seq data. Conclusions: Our study systematically examined the cellular transcriptomes affected by SYK knockdown, with biologic replicates, generated by RNA-seq technology. SYK knockdown results in the transcriptional change of multiple epithelial and mesenchymal markers, leading to mesenchymal state switching.
2023-05-24 | GSE125956 | GEO
Project description:We recently identified the nonreceptor tyrosine kinase syk as a tumor suppressor in pancreatic ductal adenocarcinoma cells. Reintroduction of syk into Panc1 cells promoted a more differentiated phenotype and retarded invasion and tumorigenic growth. Gene array analysis identified over 2,000 transcripts differentially expressed at FDR<0.01. Among these were members of the MMP2 axis, which were subsequently shown to regulate Panc1 invasion. Keywords: Genetic manipulation (stable transgene expression)
2009-09-09 | GSE18000 | GEO
Project description:Background: Among all gynecologic malignancies, epithelial ovarian cancer has the highest case-to-fatality ratio. Most patients are diagnosed at advanced stages and recurrence is common and accounts for disease-related mortality. Spleen tyrosine kinase (SYK) is an emerging cancer-associated kinase upregulated in recurrent tumors and is amenable for inhibition using small compounds that have been studied in clinical trials for autoimmune diseases. Our previous proteomic analysis identified several novel SYK substrates including EGFR and ERBB2. Here, we investigated the cross-talk between these pathways in ovarian carcinomas. Methods: Immunohistochemistry and immunoblotting were utilized to assess SYK and EGFR phosphorylation in ovarian serous carcinomas. Association with survival was determined by Kaplan-Meier analysis and the log-rank test. To study its role in EGFR signaling, SYK activity was modulated using a small molecule inhibitor, a syngeneic knockout, and an active kinase inducible system. We applied RNA-seq to investigate the SYK-regulated EGF-induced transcriptome. Results: Intense immunoreactivity of active pSYK(Y525/526) correlated with poor overall survival in two independent ovarian cancer cohorts. SYK directly phosphorylated EGFR and ERBB2, while knockout of SYK reduces their phosphorylation. Phosphorylation levels of SYK(Y525/526) positively correlated with EGFR(Y1187) and STAT3(Y705). Active SYK reduced sensitivity to the EGFR/ERBB2 inhibitor, lapatinib, and SYK non-phosphorylatable EGFR mutant was more sensitive to paclitaxel. SYK modulated the EGF-induced transcriptome, supporting its involvement in EGFR/ERBB2-regulated transcriptional activity. Conclusions: Our findings suggest an upstream role of SYK in regulating the EGFR/ERBB2 signaling, and provide a biological rationale for targeting SYK in ovarian cancer therapy.
2020-11-08 | GSE106716 | GEO
Project description:Genetic studies have highlighted microglia as pivotal in orchestrating Alzheimer’s disease (AD). Microglia that adhere to Aβ plaques acquire a transcriptional signature, “diseaseassociated microglia” (DAM), which largely emanates from the TREM2-DAP12 receptor complex that transmits intracellular signals through the protein tyrosine kinase SYK. The human TREM2R47H variant associated with high AD risk fails to activate microglia via SYK. We found that SYK-deficient microglia cannot encase Aβ plaques, accelerating brain pathology and behavioral deficits. SYK deficiency impaired the PI3K-AKT-GSK3β-mTOR pathway, incapacitating anabolic support required for attaining the DAM profile. However, SYK-deficient microglia proliferated and advanced to an Apoe-expressing prodromal stage of DAM; this pathway relied on the adaptor DAP10, which also binds TREM2. Thus, microglial responses to Aβ involve non-redundant SYK- and DAP10-pathways. Systemic administration of an antibody against CLEC7A, a receptor that directly activates SYK, rescued microglia activation in mice expressing the TREM2R47H allele, unveiling new options for AD immunotherapy.
2022-10-10 | GSE195518 | GEO
Project description:Loss of Syk in normal breast cells in vivo and in vitro: gene expression and phenotypic switch to stem-cell like with induction of invadopodia Morphological and gene microarray analysis following Syk knockdown in MCF10A reveals a loss of luminal and differentiated epithelial features with epithelial to mesenchymal transition and a gain in invadopodia and stem/ progenitor cell marker expression. These results support the role of Syk in limiting normal stem/progenitor proliferation and invasion during morphogenesis, and support the role of Syk as a critical tumor suppressor for breast cancer.
2009-11-20 | GSE16200 | GEO
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Targeted therapy studies with small molecules against kinases, such as spleen tyrosine kinase (SYK), are underway in patients with acute myeloid leukemia (AML) and show promising initial results. Identifying the potential mechanism of resistance and finding new drug combinations to overcome them, however, is essential for the long-term success of these targeted agents. Here, we conducted a genome-scale ORF resistance screen and identified activation of the RAS/MAPK/ERK signaling pathway as one major mechanism of resistance to SYK inhibition. This finding was validated in AML cell lines with innate and acquired resistance to a SYK inhibitor and in AML samples from patients who developed resistance to SYK inhibition. In order to circumvent this resistance, we demonstrate the synergistic activity of a MEK Inhibitor in combination with a SYK inhibitor in RAS mutated cells, as well as in entospletinib-resistant AML cells.
2020-01-16 | GSE129698 | GEO
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO
Project description:Neuroblastoma (NB) is considered an immunologically cold tumor and is usually less responsive to immune checkpoint blockade (ICB). Tumor-associated macrophages (TAMs) are highly infiltrated in NB tumors and promote immune escape and resistance to ICB. Hence therapeutic strategies targeting immunosuppressive TAMs can improve responses to ICB in NB. We recently discovered that spleen tyrosine kinase (Syk) reprograms TAMs toward an immunostimulatory phenotype and enhances T-cell responses in the lung adenocarcinoma model. Here we investigated if Syk is an immune-oncology target in NB and tested whether a novel immunotherapeutic approach utilizing Syk inhibitor together with radiation and ICB could provide a durable antitumor immune response in an MYCN amplified murine model of NB. Myeloid Syk KO mice and syngeneic MYCN-amplified cell lines were used to elucidate the effect of myeloid Syk on the NB tumor microenvironment (TME). In addition, the effect of Syk inhibitor, R788, on anti-tumor immunity alone or combination with anti-PDL1 mAb and radiation was also determined in murine NB models. The underlying mechanism of action of this novel therapeutic combination was also investigated. Herein, we report that Syk is a marker of NB -associated macrophages and plays a crucial role in promoting immunosuppression in the NB TME. We found that the blockade of Syk in NB-bearing mice markedly impairs tumor growth. This effect is facilitated by macrophages that become immunogenic in the absence of Syk, skewing the suppressive TME towards immunostimulation and activating anti-tumor immune responses. Moreover, combining FDA-approved Syk inhibitor, R788 (fostamatinib) along with anti-PDL1 mAb provides a synergistic effect leading to complete tumor regression and durable anti-tumor immunity in mice bearing small tumors (50 mm3) but not larger tumors (250 mm3). However, combining radiation to R788 and anti-PDL1 mAb prolongs the survival of mice bearing large NB9464 tumors.
2023-06-02 | GSE224021 | GEO