Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Litopenaeus vannamei

ABSTRACT: 16S rRNA amplicon sequencing from shrimps Targeted loci

PROVIDER: PRJNA575169 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR10209600_1.fastq.gz	Fastqsanger.gz
	SRR10209600_2.fastq.gz	Fastqsanger.gz
	SRR10209601_1.fastq.gz	Fastqsanger.gz
	SRR10209601_2.fastq.gz	Fastqsanger.gz
	SRR10209602_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

Litopenaeus vannamei

Project description:16S rRNA amplicon data of the gut microbiomes of whiteleg shrimps Metagenome

| PRJNA727439 | ENA

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Project description:16S rRNA amplicon sequencing of soil bacteria Targeted loci

| PRJNA416377 | ENA

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

Relationship between sex and disease resistance of Penaeus vannamei

Project description:To investigate the relationship between the resistance of male and female Penaeus vannamei and their immunity， we collected hemocytes from shrimps stimulated by Vibrio parahaemolyticus.

2024-04-10 | GSE253240 | GEO

Microbiota from Litopenaeus vannamei: digestive tract microbial community of Pacific white shrimp (Litopenaeus vannamei).

Project description:Bacteria capable of producing different extracellular enzymes of potential relevance in digestive processes were isolated from the stomach, hepatopancreas and intestine of Pacific white shrimp Litopenaeus vannamei. A total of 64 strains with proteolytic activity were isolated and grouped into 16 clusters based on morphological characteristics: 4 groups were isolated from the intestine; 5 from the hepatopancreas; and 7 from the stomach. Molecular methods (16S rRNA gene amplification and sequencing) and phenotypic criteria (Gram stain, catalase and oxidase tests, cell and colony morphology) were used to identify strains, which corresponded to Pseudoalteromonas and Vibrio genera. These genera are reported to form part of the digestive tract microbial community in shrimp. Both genera were isolated from all three tested tissues. One member of each morphologic group was selected for analysis of the presence of amylases, lipases/esterases and chitinases. Most of the strains had all the tested enzymes, indicating that the L. vannamei digestive tract microbiotic flora includes groups which have the potential to contribute to the degradation of dietary components.

| S-EPMC4062704 | biostudies-literature

Litopenaeus vannamei

Project description:Gut microbiota in pacific white shrimp at different culture stages via high throughput sequencing. Raw sequence reads

| PRJNA391456 | ENA

Project description:16S rRNA amplicon library of apple fruit Targeted loci environmental

| PRJNA734769 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data