Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA amplicon sequencing of commercial versus hatch-brood turkeys

PROVIDER: PRJNA659849 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR12538100_1.fastq.gz	Fastqsanger.gz
	SRR12538100_2.fastq.gz	Fastqsanger.gz
	SRR12538200_1.fastq.gz	Fastqsanger.gz
	SRR12538200_2.fastq.gz	Fastqsanger.gz
	SRR12538101_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 458

Similar Datasets

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

Quantification of mock microbial communities with metagenomes, 16S rRNA gene amplicons and metaproteomics

Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.

2017-05-12 | PXD006118 | Pride

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

Analysis of the turkey skeletal muscle transcriptome between genetic lines within a developmental stage (Experiment 2)

Project description:The purpose of Experiment 2 was two-fold: a) to evaluate a unique set of negative, distance, and mismatch control probes on the newly designed 6K TSKMLO microarray, and b) to identify differences in gene expression between two genetic lines of turkeys that phenotypically display differences in growth. Negative and mismatch controls confirmed specific hybridization using this array, and genes identified as differentially expressed between developmental stages by microarray analysis were confirmed by qRT-PCR. Novel candidate genes and pathways were identified as playing potentially crucial roles in skeletal muscle development between 2 distinct lines of turkeys with implications for improving turkey meat quality defects and growth-induced myopathies long-term. This experiment utilized turkeys from two genetic lines: RBC2, a randomly bred control line representative of a 1,967 commercial turkey, and F, a subline genetically selected from the RBC2 line for increased 16-week body weight. Skeletal muscle was collected at three critical developmental stages: 18-day embryo (18de; peak of hyperplasia), 1-day post-hatch (1d; shift from myoblast-mediated growth to satellite cell modulated growth by hypertrophy), and 16-week-old birds (16wk; completion of muscle formation and approximate age of commercial slaughter). Experiment 2 was designed to directly compare the two genetic lines, RBC2 vs. F, for each of the three stages of skeletal muscle development: 18de, 1d, and 16wk. Experiment 2 contained 10 arrays per comparison, therefore, it contained 30 arrays total. Birds were randomly assigned to an array, and hybridizations were performed in random order.

2010-01-31 | E-GEOD-19538 | biostudies-arrayexpress

Bioaerosols in swine confinement buildings: A metaproteomic view

Project description:Swine confinement buildings (SCBs) represent workplaces with high biological air pollution. It is suspected that individual components of inhalable air are causatives of chronic respiratory disease that are regularly detected among workers. In order to understand the relationship between exposure and stress, the aim of this study was to develop a method to investigate the components of bioaerosols in more detail. For this purpose, bioaerosols from pig barns were collected on quartz filters from two exclusively housed pig types (porkers and gestating sows) and subsequently analyzed via a combinatorial approach of 16S rRNA amplicon sequencing and metaproteomics. The workflow helps to clarify diversity in bioaerosols from a taxonomic perspective, but also from a functional perspective.

2024-01-26 | PXD039685 | Pride

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

The nasopharyngeal microbiota of cattle with bovine respiratory disease

Project description:The nasopharyngeal microbiota of healthy cattle vs. cattle diagnosed with BRD in a commercial feedlot setting was compared using a high-density 16S rRNA microarray (Phylochip). Nasopharyngeal samples were taken from both groups of animals (n=5) at feedlot entry (day 0) and >60 days later.

2015-06-21 | E-MTAB-3430 | biostudies-arrayexpress

Changes of intestinal flora in patients with epithelial ovarian cancer treated with PARP inhibitor first-line maintenance therapy: a non-randomized, double-blind, observational cohort study

Project description:Interventions: Follow-up observation group:no;A drug maintenance treatment group:no;Two kinds of drugs maintenance treatment group:no Primary outcome(s): 16s rRNA sequencing results;Evaluation of therapeutic response in solid tumors Study Design: Cohort study

| 105717 | ecrin-mdr-crc

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data