Ontology highlight
ABSTRACT:
PROVIDER: PRJNA666896 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR12759551_1.fastq.gz | Fastqsanger.gz | |||
| SRR12759551_2.fastq.gz | Fastqsanger.gz | |||
| SRR12759552_1.fastq.gz | Fastqsanger.gz | |||
| SRR12759552_2.fastq.gz | Fastqsanger.gz | |||
| SRR12759553_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 32 |
Similar Datasets
Project description:Primer ID Sequencing of HIV-1 env gene to reveal X4 variants
| PRJNA314959 | ENA
Project description:A cDNA library was constructed by Novogene (CA, USA) using a Small RNA Sample Pre Kit, and Illumina sequencing was conducted according to company workflow, using 20 million reads. Raw data were filtered for quality as determined by reads with a quality score > 5, reads containing N < 10%, no 5' primer contaminants, and reads with a 3' primer and insert tag. The 3' primer sequence was trimmed and reads with a poly A/T/G/C were removed
2021-07-21 | GSE180131 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Primer ID sequencing to measure the rate of cytosine spontaneous deamination
| PRJNA308499 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Small interspersed elements (SINEs) is transcribed by RNA polymerase III (Pol III) to produce RNAs of typically 100 to 500 nucleotides in length. Although the abundance of SINE RNAs can be analyzed by Northern blotting and primer extension, the nature (sequence, exact length, and genomic origin) of these RNAs cannot be revealed by these methods. Moreover, mRNA sequencing (mRNA-seq) is not able to distinguish bona fide SINE RNAs and SINE sequences present in longer transcripts. To elucidate the abundance, source loci, and sequence nature of SINE RNAs, we have established a deep sequencing method, designated as melRNA-seq (medium length RNA-seq), which can determine whole-length sequences of RNAs. The total RNA samples were treated with 5' Pyrophosphohydrolase (RppH), which allowed ligation of an RNA adaptor to the 5’ end of intact SINE RNAs. Another adaptor was ligated to the 3’ end, followed by reverse transcription, PCR amplification, size selection, and single-end deep sequencing. Analysis of two biological replicates of RNAs from mouse spermatogonia showed high reproducibility of the SINE expression data both at family level and locus level. Therefore, this new method can be used for the quantification and detailed sequence analysis of medium length non-coding RNAs, such as rRNA, snRNA, tRNAs, and SINE RNAs. The dynamic range is much wider than Northern blotting and primer extension.
2021-07-01 | GSE171593 | GEO
Project description:Eukaryotic genes often generate a variety of RNA isoforms that can lead to functionally distinct protein variants. The synthesis and stability of RNA isoforms is however poorly characterized. The reason for this is that current methods to quantify RNA metabolism use short-read sequencing that cannot detect RNA isoforms. Here we present nanopore sequencing-based Isoform Dynamics (nano-ID), a method that detects newly synthesized RNA isoforms and monitors isoform metabolism. nano-ID combines metabolic RNA labeling, long-read nanopore sequencing of native RNA molecules and machine learning. nano-ID derived RNA stability estimates enable a distinctive evaluation of stability determining factors such as sequence, poly(A)-tail length, RNA secondary structure, translation efficiency and RNA binding proteins. Application of nano-ID to the heat shock response in human cells reveals that many RNA isoforms change their stability. nano-ID also shows that the metabolism of individual RNA isoforms differs strongly from that estimated for the combined RNA signal at a specific gene locus. nano-ID enables studies of RNA metabolism on the level of single RNA molecules and isoforms in different cell states and conditions.
2020-05-06 | GSE127890 | GEO
Project description:Prevailing poly(dT)-primed 3’ single-cell RNA-seq protocols generate barcoded cDNA fragments containing the reverse transcriptase priming site, which is expected to be the poly(A) tail or a genomic adenine homopolymer. Direct sequencing across this priming site was historically difficult because of DNA sequencing errors induced by the homopolymeric primer at the ‘barcode’ end. Here, we evaluate the capability of “avidity base chemistry” DNA sequencing from Element Biosciences to sequence through this homopolymer accurately, and the impact of the additional cDNA sequence on read alignment and precise quantification of polyadenylation site usage. We find that the Element Aviti instrument sequences through the thymine homopolymer into the subsequent cDNA sequence without detectable loss of accuracy.
2024-07-30 | GSE273222 | GEO
Project description:Broadly neutralizing antibodies (bnAbs) to the HIV envelope (Env) V2-apex region are important leads for HIV vaccine design. Most V2-apex bnAbs engage Env with an uncommonly long heavy chain complementarity-determining region 3 (HCDR3), suggesting that rarity of bnAb precursors poses a challenge for vaccine priming. We created precursor sequence definitions for V2-apex HCDR3-dependent bnAbs and searched for related precursors in human antibody heavy chain ultradeep sequencing data from 14 HIV-unexposed donors. We found potential precursors in a majority of donors for only two long-HCDR3 V2-apex bnAbs, PCT64 and PG9, identifying these bnAbs as priority vaccine targets. We then engineered ApexGT Env trimers that bind inferred germlines for PCT64 and PG9 and have higher affinities for bnAbs; determined cryo-EM structures of ApexGT trimers bound to inferred germline and bnAb forms of PCT64 and PG9; and developed an mRNA-encoded cell-surface trimer for our lead ApexGT candidate. The methods and immunogens developed here have promise to assist the development of an HIV vaccine.
2023-03-11 | PXD033766 | Pride