Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

CaMK2D is a critical regulator of coactivation of leukemia stem cell factors in acute myeloid leukemia.

ABSTRACT: CaMK2D is a critical regulator of coactivation of leukemia stem cell factors in acute myeloid leukemia.

PROVIDER: PRJNA675223 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13003976_1.fastq.gz	Fastqsanger.gz
	SRR13003976_2.fastq.gz	Fastqsanger.gz
	SRR13003977_1.fastq.gz	Fastqsanger.gz
	SRR13003977_2.fastq.gz	Fastqsanger.gz
	SRR13003978_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

CaMK2D is a critical regulator of coactivation of leukemia stem cell factors in acute myeloid leukemia.

Project description:Relapse is one of the biggest challenges in treating acute myeloid leukemia (AML) due to leukemia stem cells (LSCs) resisting chemotherapy, providing a cellular reservoir to form the basis for relapse. Here, we identify CaMK2D is a critical regulator of stemness and leukemogenesis of AML. Transcriptionally, loss of CaMK2D was associated with down-regulation kinds of metabolic pathway of AML.

2021-11-08 | GSE161032 | GEO

CD97 is a Critical Regulator of Acute Myeloid Leukemia Stem Cell Function

Project description:CD97 is a Critical Regulator of Acute Myeloid Leukemia Stem Cell Function

| PRJNA557192 | ENA

CD97 is a Critical Regulator of Acute Myeloid Leukemia Stem Cell Function

Project description:Despite significant efforts to improve therapies for acute myeloid leukemia (AML), clinical outcomes remain poor. Understanding the mechanisms that regulate the development and maintenance of leukemic stem cells (LSC) is important to reveal new therapeutic opportunities. We have identified CD97, a member of the adhesion class of G-protein coupled receptors (GPCRs), as a frequently upregulated antigen of AML blasts that is a critical regulator of blast function. High levels of CD97 correlate with poor prognosis, and silencing of CD97 reduces disease aggressiveness in vivo. In order to analyze the functional pathways associated with CD97 expression, we generated RNA-sequence data from scrambled shRNA transfected (s-shRNA) and CD97 KD human AML cell line HL60, as well as from MLL-AF9 (MA9) transduced GMPs isolated from CD97-/- and WT mice. These phenotypes are due to CD97’s function to promote proliferation, survival, and the maintenance of the undifferentiated state in leukemic blasts. Collectively, our data credential CD97 as a promising therapeutic target on LSCs in AML.

2019-07-30 | GSE135028 | GEO

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Kaiso, a critical regulator of spermatogenesis

Project description:Kaiso, a critical regulator of spermatogenesis

| PRJNA436947 | ENA

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

2014-01-15 | GSE54065 | GEO

Genome-wide coactivation screen identifies BAF60a as a regulator of lipid metabolism through PGC-1alpha

Project description:Impaired mitochondrial function has been implicated in the pathogenesis of type 2 diabetes, heart failure and neurodegeneration as well as during aging. Studies with the PGC-1 transcriptional coactivators have demonstrated that these factors are key components of the regulatory network that controls mitochondrial function in mammalian cells. Here we describe a genome-wide coactivation assay to globally identify the transcriptional partners for PGC-1α. These analyses revealed a molecular signature of the PGC-1α transcriptional network, and identified BAF60a (Smarcd1), a subunit of the SWI/SNF chromatin-remodeling complex, as a critical regulator of lipid homeostasis. Adenoviral-mediated expression of BAF60a stimulates fatty acid β-oxidation in cultured hepatocytes and reduces hepatic triglyceride levels in diet-induced obese mice. BAF60a physically interacts with PGC-1α and is recruited to PPARα target genes in the fasted liver. Liver-specific RNAi knockdown of BAF60a impairs fatty acid oxidation and results in severe hepatic steatosis following starvation. These results define a role for the SWI/SNF complexes in the regulation of hepatic lipid metabolism, and reveal a potential target for therapeutic intervention. Keywords: Adenoviral transduction.

2008-08-01 | GSE9523 | GEO

Transcription profiling of mouse primaty hepatocytes reveals a coactivation screen identifies BAF60a as a regulator of lipid metabolism through PGC-1alpha

Project description:Impaired mitochondrial function has been implicated in the pathogenesis of type 2 diabetes, heart failure and neurodegeneration as well as during aging. Studies with the PGC-1 transcriptional coactivators have demonstrated that these factors are key components of the regulatory network that controls mitochondrial function in mammalian cells. Here we describe a genome-wide coactivation assay to globally identify the transcriptional partners for PGC-1Î±. These analyses revealed a molecular signature of the PGC-1Î± transcriptional network, and identified BAF60a (Smarcd1), a subunit of the SWI/SNF chromatin-remodeling complex, as a critical regulator of lipid homeostasis. Adenoviral-mediated expression of BAF60a stimulates fatty acid Î²-oxidation in cultured hepatocytes and reduces hepatic triglyceride levels in diet-induced obese mice. BAF60a physically interacts with PGC-1Î± and is recruited to PPARÎ± target genes in the fasted liver. Liver-specific RNAi knockdown of BAF60a impairs fatty acid oxidation and results in severe hepatic steatosis following starvation. These results define a role for the SWI/SNF complexes in the regulation of hepatic lipid metabolism, and reveal a potential target for therapeutic intervention. Experiment Overall Design: Primary hepatocytes were isolated from C57/Bl6J mice (10 weeks old) and transduced with recombinant adenoviruses expressing GFP or BAF60a for 40 hrs. Total RNA was isolated for array analysis.

2008-10-20 | E-GEOD-9523 | biostudies-arrayexpress

ThPOK is a critical and multifaceted regulator of myeloid lineage development

Project description:ThPOK is a critical and multifaceted regulator of myeloid lineage development

| PRJNA687746 | ENA

ThPOK is a critical and multifaceted regulator of myeloid lineage development [Fluidigm]

Project description:ThPOK is a critical and multifaceted regulator of myeloid lineage development [Fluidigm]

| PRJNA687742 | ENA